Transcript: Human NM_001367225.1

Homo sapiens carbonic anhydrase 5A (CA5A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CA5A (763)
Length:
1244
CDS:
80..982

Additional Resources:

NCBI RefSeq record:
NM_001367225.1
NBCI Gene record:
CA5A (763)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367225.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438355 GTCGTGGGAGAGAATGGTTTG pLKO_005 590 CDS 100% 6.000 8.400 N CA5A n/a
2 TRCN0000052496 CCACTACAGACTGAAGCAATT pLKO.1 445 CDS 100% 10.800 7.560 N LOC440355 n/a
3 TRCN0000149975 CAGACTGAAGCAATTTCACTT pLKO.1 451 CDS 100% 4.950 3.465 N CA5A n/a
4 TRCN0000052495 GCTGCATTTAGTTCACTGGAA pLKO.1 538 CDS 100% 2.640 1.848 N LOC440355 n/a
5 TRCN0000146325 CACTACAGACTGAAGCAATTT pLKO.1 446 CDS 100% 13.200 7.920 N CA5A n/a
6 TRCN0000052497 TGCTGGGATTACTGGACCTAT pLKO.1 749 CDS 100% 4.950 3.465 N LOC440355 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367225.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05921 pDONR223 100% 89.1% 85.1% None (many diffs) n/a
2 ccsbBroad304_05921 pLX_304 0% 89.1% 85.1% V5 (many diffs) n/a
3 TRCN0000481167 AAACCTCTTACATCTTATCGTATT pLX_317 45.4% 89.1% 85.1% V5 (many diffs) n/a
Download CSV