Construct: ORF TRCN0000481172
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008151.1_s317c1
- Derived from:
- ccsbBroadEn_08435
- DNA Barcode:
- AGCTGAGGCATTGTCTTTTGCGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM70 (54968)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481172
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54968 | TMEM70 | transmembrane protein 70 | NM_017866.6 | 99.8% | 100% | 364C>T |
| 2 | human | 54968 | TMEM70 | transmembrane protein 70 | NM_001040613.2 | 40.8% | 40.7% | 319_320delAAinsGT;321_322ins459 |
| 3 | human | 54968 | TMEM70 | transmembrane protein 70 | NR_033334.1 | 35.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 846
- ORF length:
- 780
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gtttctggcg ttgggcagcc cgtgggcggt cgaactgcct ctctgcggaa 121 ggaggactgc attgtgtgcg gccgccgcgc tccgaggtcc ccgggcctct gtctcccggg 181 cgtcctccag cagcgggcct tcggggccgg tagccggctg gagtacgggg ccttcgggag 241 ccgcgcgcct tctccggcgt ccgggtcgag cgcagatccc tgtttattgg gaaggatatg 301 ttcgattctt aaatacgcca tctgacaaat cagaagatgg aaggctaatt tatactggca 361 atatggcccg agcagtgttt ggtgtgaaat gtttctctta ttctacgagt ctgattggcc 421 ttacattttt gccatacatt tttacacaaa ataatgctat tTCTGAAAGT GTGCCTCTGC 481 CTATTCAAAT CATATTCTAT GGCATCATGG GAAGCTTTAC GGTGATCACC CCAGTGCTGC 541 TTCACTTTAT TACAAAAGGC TATGTCATTC GATTGTACCA TGAGGCCACA ACAGACACTT 601 ATAAAGCCAT TACCTACAAT GCTATGCTTG CAGAAACGAG TACAGTGTTT CACCAGAATG 661 ATGTGAAGAT TCCAGATGCT AAACATGTAT TTACCACATT TTATGCTAAA ACAAAATCAC 721 TGTTAGTTAA TCCAGTGCTC TTTCCAAACC GTGAAGACTA TATCCATCTA ATGGGTTATG 781 ACAAAGAAGA ATTTATTTTG TATATGGAAG AAACCAGTGA AGAGAAACGG CATAAAGATG 841 ACAAATGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 901 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 961 CTTGGCTTTA TATATCTTGT GGAAAGGACG AAGCTGAGGC ATTGTCTTTT GCGCCACGCG 1021 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt