Transcript: Human NR_033334.1

Homo sapiens transmembrane protein 70 (TMEM70), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-05-10
Taxon:
Homo sapiens (human)
Gene:
TMEM70 (54968)
Length:
2189
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033334.1
NBCI Gene record:
TMEM70 (54968)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129969 GCCACAACAGACACTTATAAA pLKO.1 753 3UTR 100% 15.000 12.000 N TMEM70 n/a
2 TRCN0000319358 GCCACAACAGACACTTATAAA pLKO_005 753 3UTR 100% 15.000 12.000 N TMEM70 n/a
3 TRCN0000128000 GAGTCTGATTGGCCTTACATT pLKO.1 575 3UTR 100% 5.625 3.938 N TMEM70 n/a
4 TRCN0000319286 GAGTCTGATTGGCCTTACATT pLKO_005 575 3UTR 100% 5.625 3.938 N TMEM70 n/a
5 TRCN0000148880 CGGGAAATGGTAAGTAGTGTT pLKO.1 2059 3UTR 100% 4.950 3.465 N TMEM70 n/a
6 TRCN0000129600 CCAGTGAAGAGAAACGGCATA pLKO.1 982 3UTR 100% 4.050 2.835 N TMEM70 n/a
7 TRCN0000319287 CCAGTGAAGAGAAACGGCATA pLKO_005 982 3UTR 100% 4.050 2.835 N TMEM70 n/a
8 TRCN0000130686 CTATGCTTGCAGAAACGAGTA pLKO.1 790 3UTR 100% 4.050 2.835 N TMEM70 n/a
9 TRCN0000349675 CTATGCTTGCAGAAACGAGTA pLKO_005 790 3UTR 100% 4.050 2.835 N TMEM70 n/a
10 TRCN0000104253 CCAAGACTTTGAGAATCACTA pLKO.1 1688 3UTR 100% 4.950 2.475 Y Rps20 n/a
11 TRCN0000323914 CCAAGACTTTGAGAATCACTA pLKO_005 1688 3UTR 100% 4.950 2.475 Y Rps20 n/a
12 TRCN0000104250 GCCTACCAAGACTTTGAGAAT pLKO.1 1683 3UTR 100% 4.950 2.475 Y Rps20 n/a
13 TRCN0000117622 GAGGTGGCAATTCACCGAATT pLKO.1 1559 3UTR 100% 0.000 0.000 Y RPS20 n/a
14 TRCN0000298165 GAGGTGGCAATTCACCGAATT pLKO_005 1559 3UTR 100% 0.000 0.000 Y RPS20 n/a
15 TRCN0000117625 GATCGTTTCCAGATGAGAATT pLKO.1 1744 3UTR 100% 0.000 0.000 Y RPS20 n/a
16 TRCN0000286177 GATCGTTTCCAGATGAGAATT pLKO_005 1744 3UTR 100% 0.000 0.000 Y RPS20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08435 pDONR223 100% 35.5% None (many diffs) n/a
2 ccsbBroad304_08435 pLX_304 0% 35.5% V5 (many diffs) n/a
3 TRCN0000481172 AGCTGAGGCATTGTCTTTTGCGCC pLX_317 49.3% 35.5% V5 (many diffs) n/a
4 ccsbBroadEn_01458 pDONR223 98.1% 14.5% None (many diffs) n/a
5 ccsbBroad304_01458 pLX_304 0% 14.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000474583 AACTTTCATTGAATTCTGGCGTGC pLX_317 85.3% 14.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV