Construct: ORF TRCN0000481186
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000774.1_s317c1
- Derived from:
- ccsbBroadEn_15083
- DNA Barcode:
- CACTTATCGGGGTCATTCGAGGTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- ZCCHC2 (54877)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481186
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 54877 | ZCCHC2 | zinc finger CCHC-type conta... | XM_006722493.3 | 28.1% | 6.3% | (many diffs) |
2 | human | 54877 | ZCCHC2 | zinc finger CCHC-type conta... | XM_017025802.2 | 28.1% | 6.4% | (many diffs) |
3 | human | 54877 | ZCCHC2 | zinc finger CCHC-type conta... | NM_017742.6 | 26.3% | 5.9% | (many diffs) |
4 | human | 54877 | ZCCHC2 | zinc finger CCHC-type conta... | XR_245462.2 | 23.8% | (many diffs) | |
5 | human | 54877 | ZCCHC2 | zinc finger CCHC-type conta... | XR_001753205.1 | 20.1% | (many diffs) | |
6 | human | 54877 | ZCCHC2 | zinc finger CCHC-type conta... | NR_126534.2 | 14.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1095
- ORF length:
- 1029
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gggcggcggc gggcttggcg gcgctgcgcg agcaggagcg ggtatacgag 121 tggttcgggc tggtgctggg ctcggcgcag cgcctggagt tcatgtgcgg gctgctggac 181 ctgtgcaacc cgctggagct gcgcttcctt ggctcgtgcc tggaggacct ggcgcgcaag 241 gactaccact acctgcgcga ctcggaggcc aaggccaacg gcctctcgga cccggggccg 301 ctggccgact tccgagagcc cgcggtgcgc tcgcgcctca tcgtctacct ggcgctgctg 361 ggctcggaga accgggaggc cgctggccgt ctgcaccgcc tgctacccca ggtggactcg 421 gtgctcaaaa gcctgcgcgc ggcccggggc gagggctcgc ggggcggcgc ggaggacgag 481 cgcggcgagg acggcgacgg cgagcaggac gccgagaagg acggctcagg cccggaaggc 541 ggcattgtgg agccgccggg cggcggcggg cttggctcca gggcccagga ggaactgctg 601 ctgctcttca ccatggcctc gctgcacccg gctttctcct tccaccagcg ggtcaccctg 661 agggaacact tggagaggct ccgcgccgcg ctccgcgggg gccccgagga cgcggaggtg 721 gaggtagagc cgtgcaagtt tgccggcccc agggcccagg taaggcgcac ggagcctccc 781 tGGACTCGCG GTGCGATCGC TGCCCCGGCG GCCTCCCCGG CCTCGCTCTC GGACGCCCCT 841 TGCCCGAGCC CCAGCCCGGC GCAGGTGGCT CGGAATCCCC ACCCGGCAGC TCCCAGCGCC 901 AGAGGGCTGA GCTTCGTCTC GCTGGGCCGC TCCGTTCCAC TCCCCCACCC CACCCCACAC 961 CCCGGCAGAC ACAGCCACCC GCCATCACAG AATGCTCTAG AAGTCCCTTC CGTGCCACGG 1021 TGTTGCCACG GAAGACGTGG AGCTCCCCGC CCGGGGCCCC TCTCGGAGGA AAAGTGTCGG 1081 GACGTTTTTG GCTCTGAGCA TCTCAGCGCT CGGTGCGGGA GCCGCGGGGC GCTGGAGGAA 1141 CCTGTGTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT 1201 CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT 1261 TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACACTTATC GGGGTCATTC GAGGTCACGC 1321 GTTAAGTCga caatcaacct ctggattaca aaatttgtga aagatt