Transcript: Human XR_245462.2

PREDICTED: Homo sapiens zinc finger CCHC-type containing 2 (ZCCHC2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZCCHC2 (54877)
Length:
3904
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_245462.2
NBCI Gene record:
ZCCHC2 (54877)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_245462.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240881 GTGTTGCAGCATGCCATAATC pLKO_005 1510 3UTR 100% 13.200 18.480 N ZCCHC2 n/a
2 TRCN0000073040 CCTACACAGTATCAATAACTT pLKO.1 1410 3UTR 100% 5.625 7.875 N ZCCHC2 n/a
3 TRCN0000240882 CTGCAGACTGAAACGAGTAAA pLKO_005 3542 3UTR 100% 13.200 10.560 N ZCCHC2 n/a
4 TRCN0000073041 CCTTCTAATGATACGTTGGAT pLKO.1 3520 3UTR 100% 3.000 2.400 N ZCCHC2 n/a
5 TRCN0000240884 ACCCAAGTATCAGCATATTTC pLKO_005 2145 3UTR 100% 13.200 9.240 N ZCCHC2 n/a
6 TRCN0000240880 ATCCATCAACAACTAGGTTTA pLKO_005 2021 3UTR 100% 10.800 7.560 N ZCCHC2 n/a
7 TRCN0000073042 CCCGCTTTGCATCTTACAGTT pLKO.1 2431 3UTR 100% 4.950 3.465 N ZCCHC2 n/a
8 TRCN0000073039 CCTACCAATGTGAAGGTAGTT pLKO.1 2698 3UTR 100% 0.495 0.347 N ZCCHC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_245462.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15083 pDONR223 57.5% 23.8% None (many diffs) n/a
2 ccsbBroad304_15083 pLX_304 0% 23.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481186 CACTTATCGGGGTCATTCGAGGTC pLX_317 34.1% 23.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV