Construct: ORF TRCN0000481346
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018093.1_s317c1
- Derived from:
- ccsbBroadEn_01754
- DNA Barcode:
- CGCACCATGCACTAGAGCTTTTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UCK2 (7371)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481346
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7371 | UCK2 | uridine-cytidine kinase 2 | NM_012474.5 | 100% | 100% | |
| 2 | human | 7371 | UCK2 | uridine-cytidine kinase 2 | NM_001363568.2 | 87.3% | 87.4% | (many diffs) |
| 3 | mouse | 80914 | Uck2 | uridine-cytidine kinase 2 | NM_030724.3 | 90.2% | 98% | (many diffs) |
| 4 | mouse | 80914 | Uck2 | uridine-cytidine kinase 2 | XM_006497040.3 | 78.7% | 85.4% | (many diffs) |
| 5 | mouse | 80914 | Uck2 | uridine-cytidine kinase 2 | XM_017312968.1 | 60.9% | 62.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 849
- ORF length:
- 783
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cggggacagc gagcagaccc tgcagaacca ccagcagccc aacggcggcg 121 agcccttcct tataggcgtc agcgggggaa cagctagcgg caagtcttcc gtgtgtgcta 181 agatcgtgca gctcctgggg cagaatgagg tggactatcg ccagaagcag gtggtcatcc 241 tgagccagga tagcttctac cgtgtcctta cctcggagca gaaggccaaa gccctgaagg 301 gccagttcaa ctttgaccac ccggatgcct ttgacaatga actcattctc aaaacactca 361 aagaaatcac tgaagggaaa acagtccaga tccccgtgta tgactttgtc tcccattccc 421 ggaaggagga gacagttact gtctatcccg cagacgtggt gctctttgaa gggatcctgg 481 ccTTCTACTC CCAGGAGGTA CGAGACCTGT TCCAGATGAA GCTTTTTGTG GATACAGATG 541 CGGACACCCG GCTCTCACGC AGAGTATTAA GGGACATCAG CGAGAGAGGC AGGGATCTTG 601 AGCAGATTTT ATCTCAGTAC ATTACGTTCG TCAAGCCTGC CTTTGAGGAA TTCTGCTTGC 661 CAACAAAGAA GTATGCTGAT GTGATCATCC CTAGAGGTGC AGATAATCTG GTGGCCATCA 721 ACCTCATCGT GCAGCACATC CAGGACATCC TGAATGGAGG GCCCTCCAAA CGGCAGACCA 781 ATGGCTGTCT CAACGGCTAC ACCCCTTCAC GCAAGAGGCA GGCATCGGAG TCCAGCAGCA 841 GGCCGCATTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 901 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 961 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACGCACC ATGCACTAGA GCTTTTTTAC 1021 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt