Transcript: Mouse XM_006497040.3

PREDICTED: Mus musculus uridine-cytidine kinase 2 (Uck2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uck2 (80914)
Length:
4802
CDS:
626..1315

Additional Resources:

NCBI RefSeq record:
XM_006497040.3
NBCI Gene record:
Uck2 (80914)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276698 TTCCTAGAGGTGCCGACAATC pLKO_005 1152 CDS 100% 10.800 15.120 N Uck2 n/a
2 TRCN0000024912 CTGCTTGCCAACAAAGAAATA pLKO.1 1117 CDS 100% 13.200 9.240 N Uck2 n/a
3 TRCN0000276634 CTGCTTGCCAACAAAGAAATA pLKO_005 1117 CDS 100% 13.200 9.240 N Uck2 n/a
4 TRCN0000276633 GGAGATGAAATGCCTTGATTT pLKO_005 1437 3UTR 100% 13.200 9.240 N Uck2 n/a
5 TRCN0000024909 GACAACGAACTCATCTTCAAA pLKO.1 797 CDS 100% 5.625 3.938 N Uck2 n/a
6 TRCN0000276680 GACAACGAACTCATCTTCAAA pLKO_005 797 CDS 100% 5.625 3.938 N Uck2 n/a
7 TRCN0000024911 GTGCTAAGATCGTCCAGCTTT pLKO.1 639 CDS 100% 4.950 3.465 N Uck2 n/a
8 TRCN0000024913 TGAGGTGGATTACCACCAGAA pLKO.1 670 CDS 100% 0.405 0.284 N Uck2 n/a
9 TRCN0000024910 ACGTTTGTGAAGCCTGCCTTT pLKO.1 1088 CDS 100% 4.050 2.430 N Uck2 n/a
10 TRCN0000276697 ACGTTTGTGAAGCCTGCCTTT pLKO_005 1088 CDS 100% 4.050 2.430 N Uck2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01753 pDONR223 100% 78.7% 85.4% None (many diffs) n/a
2 ccsbBroad304_01753 pLX_304 0% 78.7% 85.4% V5 (many diffs) n/a
3 TRCN0000479497 CGTGTTCTCGGGGCCATCCACCCA pLX_317 46.9% 78.7% 85.4% V5 (many diffs) n/a
4 ccsbBroadEn_14875 pDONR223 0% 78.7% 85.4% None (many diffs) n/a
5 ccsbBroad304_14875 pLX_304 0% 78.7% 85.4% V5 (many diffs) n/a
6 TRCN0000465610 CCTGTACCCGCACTACGTGTTGTA pLX_317 45.8% 78.7% 85.4% V5 (many diffs) n/a
7 ccsbBroadEn_01754 pDONR223 100% 78.7% 85.4% None (many diffs) n/a
8 ccsbBroad304_01754 pLX_304 0% 78.7% 85.4% V5 (many diffs) n/a
9 TRCN0000481346 CGCACCATGCACTAGAGCTTTTTT pLX_317 46.9% 78.7% 85.4% V5 (many diffs) n/a
10 TRCN0000489848 AAAATTCCTGGGTCCCTCTTAGTT pLX_317 100% 43.3% 47.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV