Construct: ORF TRCN0000481351
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014861.1_s317c1
- Derived from:
- ccsbBroadEn_08387
- DNA Barcode:
- AATTACAGAAGTTTCTTTTCTATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RBM47 (54502)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481351
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54502 | RBM47 | RNA binding motif protein 47 | NM_001098634.2 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 2 | human | 54502 | RBM47 | RNA binding motif protein 47 | NM_001371113.1 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 3 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_005248103.4 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 4 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_005248108.4 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 5 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_005248109.4 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 6 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_011513707.2 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 7 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_011513708.2 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 8 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_017008304.2 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 9 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_017008306.2 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 10 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_017008307.1 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 11 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_017008308.1 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 12 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_024454098.1 | 99.8% | 99.8% | 57C>G;1212T>C;1693A>G |
| 13 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_017008309.2 | 99.6% | 99.6% | (many diffs) |
| 14 | human | 54502 | RBM47 | RNA binding motif protein 47 | NM_001371114.1 | 93.4% | 93.4% | 0_1ins114;1098T>C;1579A>G |
| 15 | human | 54502 | RBM47 | RNA binding motif protein 47 | NM_019027.4 | 88.2% | 88.1% | 57C>G;1121_1122ins207;1486A>G |
| 16 | human | 54502 | RBM47 | RNA binding motif protein 47 | XM_017008310.2 | 88.2% | 88.1% | 57C>G;1121_1122ins207;1486A>G |
| 17 | mouse | 245945 | Rbm47 | RNA binding motif protein 47 | NM_001127382.2 | 87.2% | 94.2% | (many diffs) |
| 18 | mouse | 245945 | Rbm47 | RNA binding motif protein 47 | NM_139065.3 | 87.2% | 94.2% | (many diffs) |
| 19 | mouse | 245945 | Rbm47 | RNA binding motif protein 47 | NM_178446.4 | 87.2% | 94.2% | (many diffs) |
| 20 | mouse | 245945 | Rbm47 | RNA binding motif protein 47 | XM_006503956.2 | 87.2% | 94.2% | (many diffs) |
| 21 | mouse | 245945 | Rbm47 | RNA binding motif protein 47 | NM_001291226.1 | 76.9% | 83.1% | (many diffs) |
| 22 | mouse | 245945 | Rbm47 | RNA binding motif protein 47 | XM_006503962.1 | 76.9% | 83.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1848
- ORF length:
- 1779
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaccgcagag gattccaccg cagccatgag cagtgactcg gccgccgggt 121 cctcggccaa ggtgcccgag ggcgtggcgg gcgcgcccaa cgaggcagca ctgctggcgc 181 tgatggagcg cacgggctac agcatggtgc aagagaacgg gcagcgcaag tacggcggcc 241 caccgcccgg ctgggagggc ccgcacccgc agcgtggctg cgaggtcttc gtgggcaaga 301 tcccgcgcga cgtgtacgag gacgagctgg tgcccgtgtt cgaggccgtg ggccgcatct 361 acgagctgcg cctcatgatg gactttgacg gcaagaaccg cggctacgcc ttcgtcatgt 421 actgccacaa gcacgaggcc aagcgcgcag tgcgtgagct caacaactac gagatccgcc 481 cgggccgcct gctcggcgtg tgctgcagcg tggacaactg ccgcctcttc atcggcggga 541 tccccaagat gaagaagcgc gaggaaatcc tggaggagat tgccaaggtc accgagggcg 601 tgctggacgt gatcgtctac gccagcgcgg ccgacaagat gaagaaccgc ggcttcgcct 661 tcgtggagta cgagagccac cgcgcggctg ccatggctcg ccgcaagctc atgcctggcc 721 gcatccagct gtggggccac cagatcgccg tggactgggc cgaacctgag atcgacgtgg 781 acgaggacgt gatggagacc gtgaagatcc tctacgtgcg caacctcatg atcgagacca 841 ccgaggacac catcaagaag agcttcggcc agttcaaccc cggctgcgtg gagcgcgtca 901 agaagatccg cgactacgcc ttcgtgcact tcaccagccg cgaggatgcc gtgcatgcca 961 tgaacaacct caacggcact gagctggagg gctcgtgcct ggaggtcacg ctggccaagc 1021 ccgtggacaa ggagcagtac tcgcgctacc agaaggcagc caggggcggc ggcgcggctg 1081 aggcagcgca gcagcccagc tacgtgtact cctgcgaccc ctacacactg gcctactacg 1141 gctaccccta caacgcgctc attgggccca acagggacta ctttgtgaaa gcaggcagca 1201 taagaggccg agggcgaggt gcagctggca acagagcccc agggcctagg ggttcctacc 1261 tcgggggata ttctgctggc cgtggtatat atagccgata tcatgaaggg aaaggaaagc 1321 agcaagaaaa aggatatgaa ctggtgccga atttggaaat ccctaccgtc aacccagttg 1381 ccattaaacc tggtacagta gccatccctg ccattggggc tcagtattcc atgtttccag 1441 cagctccagc ccctaaaatg attgaagatg gcaaaatcca cacagtggag cacatgatca 1501 gccccattgc tgtgcagcca gacccagcca gtgctgctgc cgccgcagcc gcggccgcag 1561 ccgccgcagc cgctgtcatt cccactgtgt cGACGCCACC ACCTTTCCAG GGCCGCCCAA 1621 TAACTCCAGT ATACACGGTG GCTCCAAACG TTCAGAGAAT TCCTACTGCC GGGATCTACG 1681 GGGCCAGTTA CGTGCCATTT GCTGCTCCAG CTACAGCCAC GATCGCCACA CTACAGAAGA 1741 ACGCGGCAGC CGCGGCCGCC GTGTATGGAG GATACGCAGG CTACATACCT CAGGCCTTCC 1801 CTGCTGCTGC CATTCAGGTC CCCATCCCCG ACGTCTACCA GACATACTTG CCAACTTTCT 1861 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1921 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1981 GTGGAAAGGA CGAAATTACA GAAGTTTCTT TTCTATCACG CGTTAAGTCg acaatcaacc 2041 tctggattac aaaatttgtg aaagatt