Transcript: Mouse NM_139065.3

Mus musculus RNA binding motif protein 47 (Rbm47), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rbm47 (245945)
Length:
4705
CDS:
262..2034

Additional Resources:

NCBI RefSeq record:
NM_139065.3
NBCI Gene record:
Rbm47 (245945)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139065.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123518 CGTGGTATATATAGCCGATAT pLKO.1 1480 CDS 100% 10.800 15.120 N Rbm47 n/a
2 TRCN0000123514 CCCGCGTTCATACATTTCTAA pLKO.1 2257 3UTR 100% 5.625 4.500 N Rbm47 n/a
3 TRCN0000123515 CCGTCCAATAACTCCTGTGTA pLKO.1 1806 CDS 100% 4.950 3.960 N Rbm47 n/a
4 TRCN0000123517 CATGATGGATTTCGATGGCAA pLKO.1 567 CDS 100% 2.640 2.112 N Rbm47 n/a
5 TRCN0000123516 CGACTCATGATGGATTTCGAT pLKO.1 562 CDS 100% 3.000 2.100 N Rbm47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139065.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08387 pDONR223 100% 87.2% 94.2% None (many diffs) n/a
2 ccsbBroad304_08387 pLX_304 0% 87.2% 94.2% V5 (many diffs) n/a
3 TRCN0000481351 AATTACAGAAGTTTCTTTTCTATC pLX_317 14.8% 87.2% 94.2% V5 (many diffs) n/a
Download CSV