Construct: ORF TRCN0000481378
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014227.1_s317c1
- Derived from:
- ccsbBroadEn_08769
- DNA Barcode:
- AGGACAAAACCGTCTGGTGACCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAB40C (57799)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481378
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57799 | RAB40C | RAB40C, member RAS oncogene... | NM_001172663.1 | 99.8% | 99.6% | 191A>G |
| 2 | human | 57799 | RAB40C | RAB40C, member RAS oncogene... | NM_001172664.1 | 99.8% | 99.6% | 191A>G |
| 3 | human | 57799 | RAB40C | RAB40C, member RAS oncogene... | NM_001172665.1 | 99.8% | 99.6% | 191A>G |
| 4 | human | 57799 | RAB40C | RAB40C, member RAS oncogene... | NM_021168.5 | 99.8% | 99.6% | 191A>G |
| 5 | human | 57799 | RAB40C | RAB40C, member RAS oncogene... | NM_001172666.2 | 93.1% | 92.8% | 191A>G;340_341ins57 |
| 6 | mouse | 224624 | Rab40c | Rab40C, member RAS oncogene... | NM_139154.2 | 90.3% | 98.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 912
- ORF length:
- 843
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggctcgcag ggcagtccgg tgaagagcta cgactacctg ctcaagttcc 121 tgctggtggg cgacagcgac gtgggcaagg gcgagatcct ggagagcctg caggacggcg 181 cggcagagtc cccgtacgcc tacagtaacg ggatcgacta caagaccacc accatcctgc 241 tggacggccg gcgcgtgagg ctggagctct gggacacgtc gggccagggc cggttctgca 301 ccatcttcag gtcctactcc aggggcgctc aggggatcct cttggtgtat gacatcacca 361 accgctggtc ctttgacggc atcgaccgct ggatcaagga gatcgatgag catgcacccg 421 gagtcccccg gatcttggtt ggaaaccggc tgcacctggc cttcaagcgg caggtcccga 481 cggagcaggc ccgcgcgtac gcagagaaga actgcatgac cttctttgag gTCAGCCCCC 541 TGTGCAACTT CAACGTCATC GAGTCCTTCA CGGAGCTATC CCGCATCGTG CTCATGCGGC 601 ACGGCATGGA GAAGATCTGG AGGCCCAACC GAGTGTTCAG CCTGCAGGAC CTCTGCTGCC 661 GGGCCATCGT CTCCTGCACC CCCGTGCACC TCATCGACAA GCTTCCACTG CCCGTCACCA 721 TCAAGAGCCA CCTCAAGTCC TTCTCGATGG CCAACGGCAT GAACGCGGTC ATGATGCACG 781 GCCGTTCCTA CTCCCTGGCC AGCGGGGCCG GGGGCGGCGG CAGCAAGGGC AACAGCCTCA 841 AGAGGTCCAA GTCCATCCGT CCACCCCAGA GCCCCCCCCA GAACTGCTCG CGGAGTAACT 901 GCAAGATCTC CTTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 961 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1021 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAAGG ACAAAACCGT CTGGTGACCA 1081 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t