Transcript: Human NM_001172663.1

Homo sapiens RAB40C, member RAS oncogene family (RAB40C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
RAB40C (57799)
Length:
2735
CDS:
223..1068

Additional Resources:

NCBI RefSeq record:
NM_001172663.1
NBCI Gene record:
RAB40C (57799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230611 AGTAACGGGATCGACTACAAG pLKO_005 358 CDS 100% 4.950 6.930 N RAB40C n/a
2 TRCN0000230614 CTCGCGGAGTAACTGCAAGAT pLKO_005 1041 CDS 100% 4.950 6.930 N RAB40C n/a
3 TRCN0000047623 CTACAGTAACGGGATCGACTA pLKO.1 354 CDS 100% 4.050 5.670 N RAB40C n/a
4 TRCN0000047626 CTTCAACGTCATCGAGTCCTT pLKO.1 702 CDS 100% 2.640 3.696 N RAB40C n/a
5 TRCN0000218396 ATGAACTACCAGATGAGTAAG pLKO_005 2435 3UTR 100% 10.800 7.560 N RAB40C n/a
6 TRCN0000047627 GATCCTCTTGGTGTATGACAT pLKO.1 489 CDS 100% 4.950 3.465 N RAB40C n/a
7 TRCN0000230612 TCCTCTTGGTGTATGACATCA pLKO_005 491 CDS 100% 4.950 3.465 N RAB40C n/a
8 TRCN0000230613 TCGAGTCCTTCACGGAGCTAT pLKO_005 713 CDS 100% 4.950 3.465 N RAB40C n/a
9 TRCN0000047624 CCAGAACTGCTCGCGGAGTAA pLKO.1 1032 CDS 100% 1.650 1.155 N RAB40C n/a
10 TRCN0000047625 CGACCGCTGGATCAAGGAGAT pLKO.1 537 CDS 100% 1.350 0.945 N RAB40C n/a
11 TRCN0000380513 TGGATCAAGGAGATCGATGAG pLKO_005 544 CDS 100% 4.050 2.430 N Rab40c n/a
12 TRCN0000054848 CTGTGCAACTTCAACGTCATT pLKO.1 694 CDS 100% 4.950 2.970 N Rab40c n/a
13 TRCN0000287392 CTGTGCAACTTCAACGTCATT pLKO_005 694 CDS 100% 4.950 2.970 N Rab40c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08769 pDONR223 100% 99.8% 99.6% None 191A>G n/a
2 ccsbBroad304_08769 pLX_304 0% 99.8% 99.6% V5 191A>G n/a
3 TRCN0000481378 AGGACAAAACCGTCTGGTGACCAA pLX_317 45.1% 99.8% 99.6% V5 191A>G n/a
Download CSV