Construct: ORF TRCN0000481430
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008195.1_s317c1
- Derived from:
- ccsbBroadEn_11840
- DNA Barcode:
- TGTGTTTCTCCGCACTCTCAGCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZBTB32 (27033)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481430
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 27033 | ZBTB32 | zinc finger and BTB domain ... | XM_017026590.1 | 95.9% | 95.4% | (many diffs) |
2 | human | 27033 | ZBTB32 | zinc finger and BTB domain ... | NM_014383.3 | 62% | 60.5% | 880_1022del;1050_1461del |
3 | human | 27033 | ZBTB32 | zinc finger and BTB domain ... | XM_011526718.2 | 62% | 60.5% | 880_1022del;1050_1461del |
4 | human | 27033 | ZBTB32 | zinc finger and BTB domain ... | XM_024451451.1 | 62% | 60.5% | 880_1022del;1050_1461del |
5 | human | 27033 | ZBTB32 | zinc finger and BTB domain ... | XM_017026588.1 | 57.2% | 56.4% | (many diffs) |
6 | human | 27033 | ZBTB32 | zinc finger and BTB domain ... | XR_935793.2 | 42.6% | 1_519del;1426_2126del | |
7 | human | 27033 | ZBTB32 | zinc finger and BTB domain ... | XR_001753659.1 | 42% | 1_353del;1233_1426del;1454_2154del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 972
- ORF length:
- 906
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cctgcccccc ataagactgc ccagccccta tggctctgat cggctggtac 121 agctagcagc caggctccgg ccagcactct gtgatactct gatcaccgta gggagccagg 181 agttccccgc ccacagcctg gtgctagcag gtgtcagcca gcagctgggc cgcaggggcc 241 agtgggctct gggagaaggc atcagccctt ctacctttgc ccagctcctg aactttgtgt 301 atggggagag tgtagagctg cagcctggag agctaaggcc ccttcaggag gcggccaggg 361 ccttgggagt gcagtccctg gaagaggcat gctggagggc tcgaggggac agggctaaaa 421 agccagatcc aggcctgaag aaacatcagg aggagccaga gaaaccctca aggaatcctg 481 agagagaact gggggaccct ggagagaagc agaaaccaga acaggtttct agaactggtg 541 ggagagaaca ggagatgttg cacaagcact cgcCACCAAG AGGCAGACCC GAGATGGCAG 601 GAGCAACGCA GGAGGCTCAG CAGGAACAGA CCAGGTCAAA GGAGAAACGC CTCCAAGCCC 661 CTGTTGGCCA AAGGGGAGCA GATGGGAAGC ATGGAGTGCT CACGTGGTTG AGGGAAAATC 721 CAGGGGGCTC TGAGGAAAGT CTGCGCAAGC TCCCTGGCCC CCTTCCCCCA GCAGGCTCCC 781 TGCAAACCAG CGTCACCCCT AGGCCCTCGT GGGCTGAGGC CCCTTGGTTG GTGGGGGGCC 841 AGCCTGCCCT GTGGAGCATC CTGCTGATGC CGCCCAGATA TGGCATTCCC TTCTACCATA 901 GCACCCCCAC CACTGGAGCC TGGCAGGAGG TCTGGCGGGA ACAGAGGCGC ACTTGCAACC 961 TGTGCGGGTC ATGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1021 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1081 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATGT GTTTCTCCGC ACTCTCAGCG 1141 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t