Transcript: Human XM_024451451.1

PREDICTED: Homo sapiens zinc finger and BTB domain containing 32 (ZBTB32), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZBTB32 (27033)
Length:
2172
CDS:
423..1886

Additional Resources:

NCBI RefSeq record:
XM_024451451.1
NBCI Gene record:
ZBTB32 (27033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422674 CTTAGCCAAGAGTCCAATTAA pLKO_005 1904 3UTR 100% 15.000 21.000 N ZBTB32 n/a
2 TRCN0000430450 ATGGAGTGCTCACGTGGTTGA pLKO_005 1048 CDS 100% 4.050 3.240 N ZBTB32 n/a
3 TRCN0000015596 TCAAAGGAGAAACGCCTCCAA pLKO.1 993 CDS 100% 2.640 2.112 N ZBTB32 n/a
4 TRCN0000015597 AGGATCCCACTGTCCCTAAAT pLKO.1 1302 CDS 100% 13.200 9.240 N ZBTB32 n/a
5 TRCN0000417249 AGATATGGCATTCCCTTCTAC pLKO_005 1233 CDS 100% 4.950 3.465 N ZBTB32 n/a
6 TRCN0000015593 CCAGAGAAACCCTCAAGGAAT pLKO.1 813 CDS 100% 4.950 3.465 N ZBTB32 n/a
7 TRCN0000015594 CCAGCTCCTGAACTTTGTGTA pLKO.1 638 CDS 100% 4.950 3.465 N ZBTB32 n/a
8 TRCN0000413889 CCAGCACTCTGTGATACTCTG pLKO_005 498 CDS 100% 4.050 2.835 N ZBTB32 n/a
9 TRCN0000015595 AGAAACCAGAACAGGTTTCTA pLKO.1 868 CDS 100% 0.563 0.394 N ZBTB32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11840 pDONR223 100% 62% 60.5% None 880_1022del;1050_1461del n/a
2 ccsbBroad304_11840 pLX_304 0% 62% 60.5% V5 880_1022del;1050_1461del n/a
3 TRCN0000481430 TGTGTTTCTCCGCACTCTCAGCGC pLX_317 44.1% 62% 60.5% V5 880_1022del;1050_1461del n/a
Download CSV