Construct: ORF TRCN0000481451
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007400.1_s317c1
- Derived from:
- ccsbBroadEn_01204
- DNA Barcode:
- CCCAAAAACAAAGTTCCCAGAATG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIK3CD (5293)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481451
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | NM_005026.5 | 100% | 100% | |
| 2 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_006710687.2 | 100% | 100% | |
| 3 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_006710689.2 | 100% | 100% | |
| 4 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | NM_001350234.2 | 99.9% | 99.9% | 1519_1520insAGC |
| 5 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_024447663.1 | 99.9% | 99.9% | 1519_1520insAGC |
| 6 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | NM_001350235.1 | 97.2% | 97.2% | 777_778ins87 |
| 7 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_024447664.1 | 97.2% | 97.2% | 777_778ins87 |
| 8 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_017001476.1 | 94.6% | 94.6% | 1469_1645del |
| 9 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_017001477.1 | 94.6% | 94.6% | 1469_1645del |
| 10 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_017001478.1 | 94.6% | 94.6% | 1469_1645del |
| 11 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_017001479.1 | 94.6% | 94.6% | 1469_1645del |
| 12 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_017001480.1 | 94.6% | 94.6% | 1469_1645del |
| 13 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_017001481.1 | 94.6% | 94.6% | 1469_1645del |
| 14 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_017001482.2 | 94.6% | 94.6% | 1469_1645del |
| 15 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_024447661.1 | 94.6% | 94.6% | 1469_1645del |
| 16 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XM_017001483.2 | 92% | 92% | 777_778ins87;1382_1558del |
| 17 | human | 5293 | PIK3CD | phosphatidylinositol-4,5-bi... | XR_002956806.1 | 57.6% | 1_209del;2802_2803ins124;3218_5094del | |
| 18 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | NM_008840.3 | 88.4% | 94.6% | (many diffs) |
| 19 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538651.2 | 88.4% | 94.6% | (many diffs) |
| 20 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | NM_001164050.1 | 88.3% | 94.5% | (many diffs) |
| 21 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538650.3 | 88.3% | 94.5% | (many diffs) |
| 22 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | NM_001164052.1 | 88.3% | 94.5% | (many diffs) |
| 23 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538652.3 | 88.3% | 94.5% | (many diffs) |
| 24 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | NM_001029837.2 | 88.1% | 94.3% | (many diffs) |
| 25 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | NM_001164049.1 | 88.1% | 94.3% | (many diffs) |
| 26 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538649.2 | 88.1% | 94.3% | (many diffs) |
| 27 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_017320038.1 | 88.1% | 94.2% | (many diffs) |
| 28 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | NM_001164051.1 | 88% | 94.2% | (many diffs) |
| 29 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538647.3 | 86% | 92% | (many diffs) |
| 30 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538641.3 | 86% | 91.9% | (many diffs) |
| 31 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538642.3 | 86% | 91.9% | (many diffs) |
| 32 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538643.2 | 86% | 91.9% | (many diffs) |
| 33 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538644.3 | 86% | 91.9% | (many diffs) |
| 34 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538645.1 | 86% | 91.9% | (many diffs) |
| 35 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538646.1 | 86% | 91.9% | (many diffs) |
| 36 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_017320037.1 | 86% | 91.9% | (many diffs) |
| 37 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538648.3 | 85.9% | 91.8% | (many diffs) |
| 38 | mouse | 18707 | Pik3cd | phosphatidylinositol-4,5-bi... | XM_006538653.1 | 62.5% | 62.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 3201
- ORF length:
- 3132
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccccctggg gtggactgcc ccatggaatt ctggaccaag gaggagaatc 121 agagcgttgt ggttgacttc ctgctgccca caggggtcta cctgaacttc cctgtgtccc 181 gcaatgccaa cctcagcacc atcaagcagc tgctgtggca ccgcgcccag tatgagccgc 241 tcttccacat gctcagtggc cccgaggcct atgtgttcac ctgcatcaac cagacagcgg 301 agcagcaaga gctggaggac gagcaacggc gtctgtgtga cgtgcagccc ttcctgcccg 361 tcctgcgcct ggtggcccgt gagggcgacc gcgtgaagaa gctcatcaac tcacagatca 421 gcctcctcat cggcaaaggc ctccacgagt ttgactcctt gtgcgaccca gaagtgaacg 481 actttcgcgc caagatgtgc caattctgcg aggaggcggc cgcccgccgg cagcagctgg 541 gctgggaggc ctggctgcag tacagtttcc ccctgcagct ggagccctcg gctcaaacct 601 gggggcctgg taccctgcgg ctcccgaacc gggcccttct ggtcaacgtt aagtttgagg 661 gcagcgagga gagcttcacc ttccaggtgt ccaccaagga cgtgccgctg gcgctgatgg 721 cctgtgccct gcggaagaag gccacagtgt tccggcagcc gctggtggag cagccggaag 781 actacacgct gcaggtgaac ggcaggcatg agtacctgta tggcagctac ccgctctgcc 841 agttccagta catctgcagc tgcctgcaca gtgggttgac ccctcacctg accatggtcc 901 attcctcctc catcctcgcc atgcgggatg agcagagcaa ccctgccccc caggtccaga 961 aaccgcgtgc caaaccacct cccattcctg cgaagaagcc ttcctctgtg tccctgtggt 1021 ccctggagca gccgttccgc atcgagctca tccagggcag caaagtgaac gccgacgagc 1081 ggatgaagct ggtggtgcag gccgggcttt tccacggcaa cgagatgctg tgcaagacgg 1141 tgtccagctc ggaggtgagc gtgtgctcgg agcccgtgtg gaagcagcgg ctggagttcg 1201 acatcaacat ctgcgacctg ccccgcatgg cccgtctctg ctttgcgctg tacgccgtga 1261 tcgagaaagc caagaaggct cgctccacca agaagaagtc caagaaggcg gactgcccca 1321 ttgcctgggc caacctcatg ctgtttgact acaaggacca gcttaagacc ggggaacgct 1381 gcctctacat gtggccctcc gtcccagatg agaagggcga gctgctgaac cccacgggca 1441 ctgtgcgcag taaccccaac acggatagcg ccgctgccct gctcatctgc ctgcccgagg 1501 tggccccgca ccccgtgtac taccccgccc tggagaagat cttggagctg gggcgacaca 1561 gcgagtgtgt gcatgtcacc gaggaggagc agctgcagct gcgggaaatc ctggagcggc 1621 gggggtctgg ggagctgtat gagcacgaga aggacctggt gtggaagctg cggcatgaag 1681 tccaggagca cttcccggag gcgctagccc ggctgctgct ggtcaccaag tggaacaagc 1741 atgaggatgt ggcccagatg ctctacctgc tgtgctcctg gccggagctg cccgtcctga 1801 gcgccctgga gctgctagac ttcagcttcc ccgattgcca cgtaggctcc ttcgccatca 1861 agtcgctgcg gaaactgacg gacgatgagc tgttccagta cctgctgcag ctggtgcagg 1921 tgctcaagta cgagtcctac ctggactgcg agctgaccaa attcctgctg gaccgggccc 1981 tggccaaccg caagatcggc cacttccttt tctggcacct ccgctccgag atgcacgtgc 2041 cgtcggtggc cctgcgcttc ggcctcatcc tggaggccta ctgcaggggc agcacccacc 2101 acatgaaggt gctgatgaag cagggggaag cactgagcaa actgaaggcc ctgaatgact 2161 tcgtcaagct gagctctcag aagaccccca agccccagac caaggagctg atgcacttgt 2221 gcatgcggca ggaggcctac ctagaggccc tctcccacct gcagtcccca ctcgacccca 2281 gcaccctgct ggctgaagtc tgcgtggagc agtgcacctt catggactcc aagatgaagc 2341 ccctgtggat catgtacagc aacgaggagg caggcagcgg cggcagcgtg ggcatcatct 2401 ttaagaacgg ggatgacctc cggcaggaca tgctgaccct gcagatgatc cagctcatgg 2461 acgtcctgtg gaagcaggag gggctggacc tgaggatgac cccctatggc tgcctcccca 2521 ccggggaccg cacaggcctc attgaggtgg tactccgttc agacaccatc gccaacatcc 2581 aactcaacaa gagcaacatg gcagccacag ccgccttcaa caaggatgcc ctgctcaact 2641 ggctgaagtc caagaacccg ggggaggccc tggatcgagc cattgaggag ttcaccctct 2701 cctgtgctgg ctattgtgtg gCCACATATG TGCTGGGCAT TGGCGATCGG CACAGCGACA 2761 ACATCATGAT CCGAGAGAGT GGGCAGCTGT TCCACATTGA TTTTGGCCAC TTTCTGGGGA 2821 ATTTCAAGAC CAAGTTTGGA ATCAACCGCG AGCGTGTCCC ATTCATCCTC ACCTACGACT 2881 TTGTCCATGT GATTCAGCAG GGGAAGACTA ATAATAGTGA GAAATTTGAA CGGTTCCGGG 2941 GCTACTGTGA AAGGGCCTAC ACCATCCTGC GGCGCCACGG GCTTCTCTTC CTCCACCTCT 3001 TTGCCCTGAT GCGGGCGGCA GGCCTGCCTG AGCTCAGCTG CTCCAAAGAC ATCCAGTATC 3061 TCAAGGACTC CCTGGCACTG GGGAAAACAG AGGAGGAGGC ACTGAAGCAC TTCCGAGTGA 3121 AGTTTAACGA AGCCCTCCGT GAGAGCTGGA AAACCAAAGT GAACTGGCTG GCCCACAACG 3181 TGTCCAAAGA CAACAGGCAG TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 3241 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 3301 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACCCA AAAACAAAGT 3361 TCCCAGAATG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt