Transcript: Mouse XM_006538641.3

PREDICTED: Mus musculus phosphatidylinositol 3-kinase catalytic delta polypeptide (Pik3cd), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pik3cd (18707)
Length:
5090
CDS:
394..3618

Additional Resources:

NCBI RefSeq record:
XM_006538641.3
NBCI Gene record:
Pik3cd (18707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538641.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024647 GCTGGTGCAAGTGCTCAAATA pLKO.1 2322 CDS 100% 13.200 18.480 N Pik3cd n/a
2 TRCN0000361344 CAGCGACTGGAGTTCGATATC pLKO_005 1510 CDS 100% 10.800 15.120 N Pik3cd n/a
3 TRCN0000024644 CCTCATGCTATTCGACTACAA pLKO.1 1659 CDS 100% 4.950 6.930 N Pik3cd n/a
4 TRCN0000024646 CGCACTAAGATGCGCCAGTTT pLKO.1 811 CDS 100% 4.950 6.930 N Pik3cd n/a
5 TRCN0000361415 AGGAACAGAATAGCCATAAAT pLKO_005 3812 3UTR 100% 15.000 10.500 N Pik3cd n/a
6 TRCN0000024645 GCTACTGTGAACGAGCCTATA pLKO.1 3356 CDS 100% 10.800 7.560 N Pik3cd n/a
7 TRCN0000033274 CGTGGGCATCATCTTTAAGAA pLKO.1 2802 CDS 100% 5.625 3.938 N PIK3CD n/a
8 TRCN0000033278 GCACAGCGACAACATCATGAT pLKO.1 3165 CDS 100% 4.950 2.970 N PIK3CD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538641.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01204 pDONR223 100% 86% 91.9% None (many diffs) n/a
2 ccsbBroad304_01204 pLX_304 12.5% 86% 91.9% V5 (many diffs) n/a
3 TRCN0000481451 CCCAAAAACAAAGTTCCCAGAATG pLX_317 15.5% 86% 91.9% V5 (many diffs) n/a
Download CSV