Construct: ORF TRCN0000481456
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003622.2_s317c1
- Derived from:
- ccsbBroadEn_13473
- DNA Barcode:
- TACGCTTACCACCTCCCGTTTTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PAN3 (255967)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481456
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) | Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) | Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_017020533.1 | 99.9% | 100% | 273T>C | 
| 2 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_005266334.1 | 96.1% | 96.1% | 1_66del;339T>C | 
| 3 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_017020532.1 | 96.1% | 96.1% | 1_66del;339T>C | 
| 4 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_017020531.1 | 85% | 85% | 1_291del;564T>C | 
| 5 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_017020529.2 | 83.6% | 83.6% | 1_324del;597T>C | 
| 6 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_011535034.3 | 74.5% | 74.6% | 1_564del;837T>C | 
| 7 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_005266333.3 | 66.3% | 66.3% | 1_840del;1113T>C | 
| 8 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | NM_175854.8 | 62.3% | 62.3% | 1_1002del;1275T>C | 
| 9 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_005266332.3 | 62.1% | 62.2% | 1_1002del;1275T>C;1408_1409insCAG | 
| 10 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_011535032.3 | 51.8% | 51.8% | 1_1002del;1275T>C;2385_2385delCins277 | 
| 11 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_011535033.2 | 45.8% | 44.2% | (many diffs) | 
| 12 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_017020528.1 | 40.1% | 39.5% | (many diffs) | 
| 13 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XR_941549.2 | 38.4% | (many diffs) | |
| 14 | human | 255967 | PAN3 | poly(A) specific ribonuclea... | XM_017020530.2 | 36.1% | 35.8% | (many diffs) | 
| 15 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | XM_006504878.3 | 91.6% | 97.1% | (many diffs) | 
| 16 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | XM_006504877.3 | 91.1% | 96.6% | (many diffs) | 
| 17 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | XM_006504874.2 | 88.1% | 93.4% | (many diffs) | 
| 18 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | XM_006504873.3 | 69.3% | 64.3% | (many diffs) | 
| 19 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | NM_028291.4 | 60.9% | 64.6% | (many diffs) | 
| 20 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | XM_006504871.3 | 58.8% | 62.3% | (many diffs) | 
| 21 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | XM_006504870.3 | 57.6% | 61.2% | (many diffs) | 
| 22 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | XM_006504868.3 | 57.2% | 60.7% | (many diffs) | 
| 23 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | XM_006504869.3 | 57.1% | 60.6% | (many diffs) | 
| 24 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | XM_006504872.3 | 53.9% | 56.4% | (many diffs) | 
| 25 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | XM_017321113.1 | 53.2% | 56.2% | (many diffs) | 
| 26 | mouse | 72587 | Pan3 | PAN3 poly(A) specific ribon... | XM_011241014.2 | 40.9% | 43.4% | (many diffs) | 
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1728
- ORF length:
- 1659
- Sequence:
- 
          1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcgttgtct gctgggtctt cccctcttca ttcccccaag attactccac 121 atacttctcc tgctcccaga agaagaagtc acactccaaa tccagcaagt tacatggtgc 181 cttctagtgc ctctacatct gttaataatc ctgtttctca gactccgtct tctggtcagg 241 tgatccaaaa ggaaactgtt ggtgggacga cttacttcta tacagacaca actccagcac 301 ctttgactgg aatggtgttt ccaaactatc atatttatcc cccaactgca cctcacgttg 361 cttatatgca accgaaagca aacgcacctt ccttcttcat ggctgatgaa ctccgacagg 421 agctgatcaa cagacattta ataacaatgg ctcaaattga tcaagcagat atgccagcag 481 ttcctacaga ggttgacagc taccatagcc tattccctct agaaccactg ccacctccca 541 accggataca gaaatcaagt aattttggat atattacatc ttgctacaaa gctgtaaaca 601 gcaaagatga tctgccatat tgccttcgga ggatacatgg ttttcgtctt gttaacacaa 661 agtgcatggt gttggtcgac atgtggaaga aaattcaaca ctcaaatatc gtaactttgc 721 gtgaagtatt taccactaaa gcatttgctg agccctctct tgtgtttgca tatgatttcc 781 atgctggagg agaaactatg atgagcagac actttaatga ccctaatgct gatgcctact 841 tcaccaagag aaagtggggt cagcacgagg gaccattgcc caggcagcat gctggattat 901 tgccagaatc tcttatttgg gcatatattg tccaactaag ttctgcattg cgtaccattc 961 atacagcagg tttggcatgt cgagttatgg atccaacaaa gattctgata actggcaaaa 1021 caaggttgcg agtaaattgt gttggagttt ttgatgtttt aacatttgat aacagtcaaa 1081 ataataatcc attggcatta atggcccagt accagcaagc agatctgata tcattaggaa 1141 aagttgtgtt ggctttggct tgcaactctt tggcaggaat tcagcgagag aatttacaga 1201 aagccatgga actggtgaca atcaactatt cctctgacct gaagaatctg attttgtatt 1261 tgttgactga ccaaaacagg atgcgaagtg taaatgacat catgcCCATG ATTGGTGCTC 1321 GATTTTATAC TCAATTGGAT GCTGCTCAAA TGAGAAATGA TGTCATAGAG GAAGACCTTG 1381 CAAAGGAGGT TCAAAATGGA AGACTGTTTA GGCTCCTAGC AAAATTGGGA ACAATCAATG 1441 AGAGGCCGGA GTTTCAGAAG GATCCCACTT GGTCAGAGAC TGGAGACCGT TATCTGTTGA 1501 AACTCTTTAG GGATCATCTT TTTCATCAGG TGACAGAAGC AGGTGCTCCC TGGATTGACC 1561 TCAGTCATAT AATTTCTTGT CTTAACAAGC TAGATGCTGG TGTGCCAGAA AAAATAAGCC 1621 TGATTTCCAG AGATGAGAAG AGTGTACTTG TGGTGACCTA CAGTGACTTA AAGCGCTGCT 1681 TTGAAAATAC TTTTCAAGAA CTGATTGCAG CTGCAAATGG TCAGTTGTTG CCAACTTTCT 1741 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1801 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1861 GTGGAAAGGA CGATACGCTT ACCACCTCCC GTTTTATACG CGTTAAGTCg acaatcaacc 1921 tctggattac aaaatttgtg aaagatt 
 
 
              