Transcript: Human XM_017020533.1

PREDICTED: Homo sapiens poly(A) specific ribonuclease subunit PAN3 (PAN3), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAN3 (255967)
Length:
5260
CDS:
786..2447

Additional Resources:

NCBI RefSeq record:
XM_017020533.1
NBCI Gene record:
PAN3 (255967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414180 CACTTGTATATGCACTAATTT pLKO_005 2723 3UTR 100% 15.000 21.000 N PAN3 n/a
2 TRCN0000413059 CATTACGGACCAGGTAAATAA pLKO_005 2904 3UTR 100% 15.000 21.000 N PAN3 n/a
3 TRCN0000049807 CGAGTAAATTGTGTTGGAGTT pLKO.1 1746 CDS 100% 4.050 5.670 N PAN3 n/a
4 TRCN0000429104 GGTGTTTCCAAACTATCATAT pLKO_005 1031 CDS 100% 13.200 10.560 N PAN3 n/a
5 TRCN0000049806 CGTTGCTTATATGCAACCGAA pLKO.1 1073 CDS 100% 0.264 0.211 N PAN3 n/a
6 TRCN0000433299 ATCTCTTATTTGGGCATATAT pLKO_005 1625 CDS 100% 15.000 10.500 N PAN3 n/a
7 TRCN0000423444 CAAGCAGATCTGATATCATTA pLKO_005 1833 CDS 100% 13.200 9.240 N PAN3 n/a
8 TRCN0000049803 CCCTCTCTTGTGTTTGCATAT pLKO.1 1470 CDS 100% 10.800 7.560 N PAN3 n/a
9 TRCN0000426594 GACATGGCTAAAGACCTTAAC pLKO_005 2470 3UTR 100% 10.800 7.560 N PAN3 n/a
10 TRCN0000049804 CCAAGATTACTCCACATACTT pLKO.1 823 CDS 100% 5.625 3.938 N PAN3 n/a
11 TRCN0000120024 GCTGCTCAAATGAGAAATGAT pLKO.1 2058 CDS 100% 5.625 3.938 N Pan3 n/a
12 TRCN0000049805 CGTTATCTGTTGAAACTCTTT pLKO.1 2205 CDS 100% 4.950 3.465 N PAN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020533.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13473 pDONR223 100% 99.9% 100% None 273T>C n/a
2 ccsbBroad304_13473 pLX_304 0% 99.9% 100% V5 273T>C n/a
3 TRCN0000481456 TACGCTTACCACCTCCCGTTTTAT pLX_317 25.7% 99.9% 100% V5 273T>C n/a
Download CSV