Construct: ORF TRCN0000481561
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002073.1_s317c1
- Derived from:
- ccsbBroadEn_03210
- DNA Barcode:
- GTTTCTGAACGCCGAACGCTTGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- METTL9 (51108)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481561
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51108 | METTL9 | methyltransferase like 9 | NM_016025.5 | 100% | 100% | |
| 2 | human | 51108 | METTL9 | methyltransferase like 9 | NM_001077180.2 | 99.6% | 99.6% | 750_751insGTA |
| 3 | human | 51108 | METTL9 | methyltransferase like 9 | NM_001288659.1 | 83.1% | 81.5% | (many diffs) |
| 4 | human | 51108 | METTL9 | methyltransferase like 9 | NM_001288660.1 | 82.8% | 81.2% | (many diffs) |
| 5 | human | 51108 | METTL9 | methyltransferase like 9 | XM_017023269.1 | 60.6% | 60.6% | 0_1ins375 |
| 6 | human | 51108 | METTL9 | methyltransferase like 9 | XM_024450293.1 | 60.3% | 60.3% | 0_1ins375;375_376insGTA |
| 7 | mouse | 59052 | Mettl9 | methyltransferase like 9 | NM_021554.2 | 92.8% | 97.1% | (many diffs) |
| 8 | mouse | 59052 | Mettl9 | methyltransferase like 9 | XM_006508092.3 | 92.5% | 96.8% | (many diffs) |
| 9 | mouse | 59052 | Mettl9 | methyltransferase like 9 | XM_006508093.3 | 77.5% | 80% | (many diffs) |
| 10 | mouse | 59052 | Mettl9 | methyltransferase like 9 | XM_006508095.3 | 74% | 76.4% | (many diffs) |
| 11 | mouse | 59052 | Mettl9 | methyltransferase like 9 | XM_006508096.3 | 55.6% | 59.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1023
- ORF length:
- 954
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagactgctg gcgggctggc tgtgcctgag cctggcgtcc gtgtggctgg 121 cgcggaggat gtggacgctg cggagcccgc tcacccgctc cctgtacgtg aacatgacta 181 gcggcccggg tgggccggcg gcggccgcgg gcggcaggaa ggagaaccac cagtggtatg 241 tgtgcaacag agagaaatta tgcgaatcac tccaggctgt ctttgttcag agttaccttg 301 atcaaggaac acagatcttc ttaaacaaca gcattgagaa atcgggctgg ctatttatcc 361 aattatatca ttcttttgtg tcatctgttt ttagcctgtt tatgtctaga acatctatca 421 atgggttgct aggaagaggc tcaatgtttg tgttttcacc agatcagttt cagagactgc 481 ttaaaattaa tccagactgg aaaacccaca gacttcttga tttaggtgct ggagatggag 541 aagtcacaaa aatcatgagc cctcattttG AAGAAATCTA TGCCACTGAG CTTTCTGAAA 601 CTATGATATG GCAGCTTCAG AAAAAGAAAT ACAGAGTCCT TGGTATAAAT GAATGGCAGA 661 ATACGGGGTT CCAGTATGAT GTCATCAGCT GCCTGAACTT GCTGGACCGC TGTGATCAGC 721 CCCTGACTTT GTTAAAAGAT ATCAGAAGTG TCTTGGAGCC AACTAGAGGC AGGGTCATCC 781 TTGCCCTTGT CCTCCCCTTT CATCCCTATG TGGAAAACGT AGGTGGCAAG TGGGAGAAAC 841 CATCAGAAAT TTTGGAAATC AAAGGACAGA ACTGGGAAGA ACAAGTGAAT AGTCTGCCTG 901 AAGTTTTCAG AAAAGCTGGT TTTGTTATCG AAGCTTTCAC CAGACTACCA TACCTGTGTG 961 AAGGCGACAT GTATAATGAC TACTACGTTC TGGATGACGC TGTCTTTGTT CTCAAACCAG 1021 TATTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1081 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1141 GGCTTTATAT ATCTTGTGGA AAGGACGAGT TTCTGAACGC CGAACGCTTG CGACGCGTTA 1201 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt