Transcript: Mouse XM_006508093.3

PREDICTED: Mus musculus methyltransferase like 9 (Mettl9), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mettl9 (59052)
Length:
1355
CDS:
19..855

Additional Resources:

NCBI RefSeq record:
XM_006508093.3
NBCI Gene record:
Mettl9 (59052)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508093.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198342 GACTACTATGTTCTGGACGAT pLKO.1 808 CDS 100% 2.640 3.696 N Mettl9 n/a
2 TRCN0000178690 CCCAGACAAAGCAATAGTCAT pLKO.1 1154 3UTR 100% 4.950 3.960 N Mettl9 n/a
3 TRCN0000314283 CCCAGACAAAGCAATAGTCAT pLKO_005 1154 3UTR 100% 4.950 3.960 N Mettl9 n/a
4 TRCN0000177601 CGACATGTACAATGACTACTA pLKO.1 795 CDS 100% 4.950 3.960 N Mettl9 n/a
5 TRCN0000215650 GATGTCATCAGCTGCTTAAAT pLKO.1 508 CDS 100% 15.000 10.500 N Mettl9 n/a
6 TRCN0000197454 CTTTGTTCTCAGACCAGTATA pLKO.1 834 CDS 100% 13.200 9.240 N Mettl9 n/a
7 TRCN0000176689 CCTTTCATCCCTATGTAGAAA pLKO.1 626 CDS 100% 5.625 3.938 N Mettl9 n/a
8 TRCN0000314345 CCTTTCATCCCTATGTAGAAA pLKO_005 626 CDS 100% 5.625 3.938 N Mettl9 n/a
9 TRCN0000197945 GCAATAAAGCTGTCCATTCAA pLKO.1 1222 3UTR 100% 5.625 3.938 N Mettl9 n/a
10 TRCN0000181933 GCAGAATACAGGGTTCCAGTA pLKO.1 486 CDS 100% 4.050 2.835 N Mettl9 n/a
11 TRCN0000314280 GCAGAATACAGGGTTCCAGTA pLKO_005 486 CDS 100% 4.050 2.835 N Mettl9 n/a
12 TRCN0000128845 GATCAGTTTCAGAGACTGCTT pLKO.1 292 CDS 100% 2.640 1.848 N METTL9 n/a
13 TRCN0000178523 GTCTTTGTTCTCAGACCAGTA pLKO.1 832 CDS 100% 4.050 2.430 N Mettl9 n/a
14 TRCN0000314282 GTCTTTGTTCTCAGACCAGTA pLKO_005 832 CDS 100% 4.050 2.430 N Mettl9 n/a
15 TRCN0000129203 CCACTGAGCTTTCTGAAACTA pLKO.1 413 CDS 100% 5.625 3.938 N METTL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508093.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03210 pDONR223 100% 77.5% 80% None (many diffs) n/a
2 ccsbBroad304_03210 pLX_304 0% 77.5% 80% V5 (many diffs) n/a
3 TRCN0000481561 GTTTCTGAACGCCGAACGCTTGCG pLX_317 47.4% 77.5% 80% V5 (many diffs) n/a
Download CSV