Construct: ORF TRCN0000487711
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021909.1_s317c1
- DNA Barcode:
- CCATCTCGCTTTGTGCTCGATCAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MVB12A (93343)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487711
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 93343 | MVB12A | multivesicular body subunit... | NM_138401.4 | 100% | 100% | |
| 2 | human | 93343 | MVB12A | multivesicular body subunit... | NM_001304547.2 | 66.3% | 66.3% | 0_1ins276 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 888
- ORF length:
- 819
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggatcccgta cccgggacag actcggcgcc gctggctggc ctggcctggt 121 cgtcggcctc tgcacccccg ccgcgggggt tcagcgcgat ctcctgcacc gtcgaggggg 181 cacccgccag ctttggcaag agcttcgcgc agaaatctgg ctacttcctg tgccttagtt 241 ctctgggcag cctagagaac ccgcaggaga acgtggtggc cgatatccag atcgtggtgg 301 acaagagccc cctgccgctg ggcttctccc ccgtctgcga ccccatggat tccaaggcct 361 ctgtgtccaa gaagaaacgc atgtgtgtga agctgttgcc cctgggagcc acggacacgg 421 ctgtgtttga tgtccggctg agtgggaaga ccaagacagt gcctggatac cttcgaatag 481 gggacatggg cggctttgcc atctggtgca agaaggccaa ggccccgagg ccagtgccca 541 agccccgagg tctcagccgg gacatgcagg gcctctctct ggatgcagcc agccagccaa 601 gtaagggcgg cctcctggag cggacagcgt caaggctggg ctctcgggca TCCACTCTGC 661 GGAGGAATGA CTCCATCTAC GAGGCCTCCA GCCTCTATGG CATCTCAGCC ATGGATGGGG 721 TTCCCTTCAC ACTCCACCCA CGATTTGAGG GCAAGAGCTG CAGCCCCCTG GCCTTCTCTG 781 CTTTTGGGGA CCTGACCATC AAGTCTCTGG CGGACATTGA GGAGGAGTAT AACTACGGCT 841 TCGTGGTGGA GAAGACCGCG GCTGCCCGCC TGCCCCCCAG CGTCTCATAG AACCCAGCTT 901 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 961 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1021 CTTGTGGAAA GGACGACCAT CTCGCTTTGT GCTCGATCAT ACGCGTTAAG TCgacaatca 1081 acctctggat tacaaaattt gtgaaagatt