Construct: ORF TRCN0000487721
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021213.1_s317c1
- DNA Barcode:
- CGAATAAGGTTTCCCTAGGTTAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- RAMP1 (10267)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487721
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10267 | RAMP1 | receptor activity modifying... | NM_005855.4 | 100% | 100% | |
| 2 | human | 10267 | RAMP1 | receptor activity modifying... | NM_001308353.2 | 85.1% | 85.1% | 0_1ins66 |
| 3 | human | 10267 | RAMP1 | receptor activity modifying... | XM_017003152.2 | 85.1% | 85.1% | 0_1ins66 |
| 4 | human | 10267 | RAMP1 | receptor activity modifying... | XM_017003153.2 | 85.1% | 85.1% | 0_1ins66 |
| 5 | human | 10267 | RAMP1 | receptor activity modifying... | XM_017003154.1 | 85.1% | 85.1% | 0_1ins66 |
| 6 | human | 10267 | RAMP1 | receptor activity modifying... | XM_017003156.2 | 85.1% | 85.1% | 0_1ins66 |
| 7 | human | 10267 | RAMP1 | receptor activity modifying... | XM_017003155.1 | 59.7% | 43.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 516
- ORF length:
- 444
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcccgg gccctgtgcc gcctcccgcg gcgcggcctc tggctgctcc 121 tggcccatca cctcttcatg accactgcct gccaggaggc taactacggt gccctcctcc 181 gggagctctg cctcacccag ttccaggtag acatggaggc cgtcggggag acgctgtggt 241 gtgactgggg caggaccatc aggagctaca gggagctggc cgactgcacc tggcacatgg 301 cggagaagct gggctgcttc tggcccaatg cagaggtgga caggttcttc ctggcagtgc 361 atggccgcta cttcaggagc tgccccatct caggcagggc cgtgcgggac ccgcccggca 421 gcatcctcta ccccttcatc gtggtcccca tCACGGTGAC CCTGCTGGTG ACGGCACTGG 481 TGGTCTGGCA GAGCAAGCGC ACTGAGGGCA TTGTGTAGAA CCCAGCTTTC TTGTACAAAG 541 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 601 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 661 ACGACGAATA AGGTTTCCCT AGGTTAACAC GCGTTAAGTC gacaatcaac ctctggatta 721 caaaatttgt gaaagatt