Transcript: Human XM_017003154.1

PREDICTED: Homo sapiens receptor activity modifying protein 1 (RAMP1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAMP1 (10267)
Length:
917
CDS:
206..586

Additional Resources:

NCBI RefSeq record:
XM_017003154.1
NBCI Gene record:
RAMP1 (10267)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014209 AGGTTCTTCCTGGCAGTGCAT pLKO.1 410 CDS 100% 2.640 1.848 N RAMP1 n/a
2 TRCN0000273872 TGCCTGCCAGGAGGCTAACTA pLKO_005 214 CDS 100% 1.875 1.313 N RAMP1 n/a
3 TRCN0000273815 GCGCACTGAGGGCATTGTGTA pLKO_005 565 CDS 100% 1.650 1.155 N RAMP1 n/a
4 TRCN0000014210 CCTCACCCAGTTCCAGGTAGA pLKO.1 259 CDS 100% 1.350 0.945 N RAMP1 n/a
5 TRCN0000273873 CCTCACCCAGTTCCAGGTAGA pLKO_005 259 CDS 100% 1.350 0.945 N RAMP1 n/a
6 TRCN0000014212 CCAATGCAGAGGTGGACAGGT pLKO.1 393 CDS 100% 0.880 0.616 N RAMP1 n/a
7 TRCN0000273874 CCAATGCAGAGGTGGACAGGT pLKO_005 393 CDS 100% 0.880 0.616 N RAMP1 n/a
8 TRCN0000014208 CCCTTCTTCCAGCCAAGAAGA pLKO.1 695 3UTR 100% 0.495 0.347 N RAMP1 n/a
9 TRCN0000273814 CCCTTCTTCCAGCCAAGAAGA pLKO_005 695 3UTR 100% 0.495 0.347 N RAMP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02376 pDONR223 100% 85.1% 85.1% None 0_1ins66 n/a
2 TRCN0000488540 TGACGTACGGCAGTTCAGACTTAT pLX_317 71.8% 84.9% 84.5% V5 0_1ins66;378_379insG n/a
3 TRCN0000487721 CGAATAAGGTTTCCCTAGGTTAAC pLX_317 16.4% 85.1% 85.1% V5 (not translated due to prior stop codon) 0_1ins66 n/a
Download CSV