Construct: ORF TRCN0000487723
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021178.1_s317c1
- DNA Barcode:
- GGTATGATACCTGAGACCCTTGGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR68 (8111)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487723
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_005268110.4 | 100% | 100% | |
| 2 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_005268111.3 | 100% | 100% | |
| 3 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_005268112.3 | 100% | 100% | |
| 4 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_006720262.3 | 100% | 100% | |
| 5 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537196.2 | 100% | 100% | |
| 6 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537197.3 | 100% | 100% | |
| 7 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537198.2 | 100% | 100% | |
| 8 | human | 8111 | GPR68 | G protein-coupled receptor 68 | XM_011537199.2 | 100% | 100% | |
| 9 | human | 8111 | GPR68 | G protein-coupled receptor 68 | NM_001177676.2 | 97.3% | 97.3% | 0_1ins30 |
| 10 | human | 8111 | GPR68 | G protein-coupled receptor 68 | NM_001348437.1 | 97.3% | 97.3% | 0_1ins30 |
| 11 | human | 8111 | GPR68 | G protein-coupled receptor 68 | NM_003485.3 | 97.3% | 97.3% | 0_1ins30 |
| 12 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | XM_017315062.1 | 87.6% | 91.7% | (many diffs) |
| 13 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | NM_001177673.1 | 85.4% | 89.6% | (many diffs) |
| 14 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | NM_001177674.1 | 85.4% | 89.6% | (many diffs) |
| 15 | mouse | 238377 | Gpr68 | G protein-coupled receptor 68 | NM_175493.4 | 85.4% | 89.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1197
- ORF length:
- 1125
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaggagt gtggcccctt caggcccaaa gatggggaac atcactgcag 121 acaactcctc gatgagctgt accatcgacc ataccatcca ccagacgctg gccccggtgg 181 tctatgttac cgtgctggtg gtgggcttcc cggccaactg cctgtccctc tacttcggct 241 acctgcagat caaggcccgg aacgagctgg gcgtgtacct gtgcaacctg acggtggccg 301 acctcttcta catctgctcg ctgcccttct ggctgcagta cgtgctgcag cacgacaact 361 ggtctcacgg cgacctgtcc tgccaggtgt gcggcatcct cctgtacgag aacatctaca 421 tcagcgtggg cttcctctgc tgcatctccg tggaccgcta cctggctgtg gcccatccct 481 tccgcttcca ccagttccgg accctgaagg cggccgtcgg cgtcagcgtg gtcatctggg 541 ccaaggagct gctgaccagc atctacttcc tgatgcacga ggaggtcatc gaggacgaga 601 accagcaccg cgtgtgcttt gagcactacc ccatccaggc atggcagcgc gccatcaact 661 actaccgctt cctggtgggc ttcctcttcc ccatctgcct gctgctggcg tcctaccagg 721 gcatcctgcg cgccgtgcgc cggagccacg gcacccagaa gagccgcaag gaccagatcc 781 agcggctggt gctcagcacc gtggtcatct tcctggcctg cttcctgccc taccacgtgt 841 tgctgctggt gcgcagcgtc tgggaggcca gctgcgactt cgccaagggc gttttcaacg 901 cctaccactt ctcccTCCTG CTCACCAGCT TCAACTGCGT CGCCGACCCC GTGCTCTACT 961 GCTTCGTCAG CGAGACCACC CACCGGGACC TGGCCCGCCT CCGCGGGGCC TGCCTGGCCT 1021 TCCTCACCTG CTCCAGGACC GGCCGGGCCA GGGAGGCCTA CCCGCTGGGT GCCCCCGAGG 1081 CCTCCGGGAA AAGCGGGGCC CAGGGTGAGG AGCCCGAGCT GTTGACCAAG CTCCACCCGG 1141 CCTTCCAGAC CCCTAACTCG CCAGGGTCGG GCGGGTTCCC CACGGGCAGG TTGGCCTAGG 1201 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1261 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1321 TTTATATATC TTGTGGAAAG GACGAGGTAT GATACCTGAG ACCCTTGGCA CGCGTTAAGT 1381 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt