Construct: ORF TRCN0000487734
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021048.1_s317c1
- DNA Barcode:
- ACACTACCTACACCCTAGATAGCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- SSTR1 (6751)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487734
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 6751 | SSTR1 | somatostatin receptor 1 | NM_001049.3 | 100% | 100% | |
2 | mouse | 20605 | Sstr1 | somatostatin receptor 1 | NM_009216.3 | 89.2% | 98.7% | (many diffs) |
3 | mouse | 20605 | Sstr1 | somatostatin receptor 1 | XM_006515634.3 | 89.2% | 98.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1245
- ORF length:
- 1173
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgttcccc aatggcaccg cctcctctcc ttcctcctct cctagcccca 121 gcccgggcag ctgcggcgaa ggcggcggca gcaggggccc cggggccggc gctgcggacg 181 gcatggagga gccagggcga aatgcgtccc agaacgggac cttgagcgag ggccagggca 241 gcgccatcct gatctctttc atctactccg tggtgtgcct ggtggggctg tgtgggaact 301 ctatggtcat ctacgtgatc ctgcgctatg ccaagatgaa gacggccacc aacatctaca 361 tcctaaatct ggccattgct gatgagctgc tcatgctcag cgtgcccttc ctagtcacct 421 ccacgttgtt gcgccactgg cccttcggtg cgctgctctg ccgcctcgtg ctcagcgtgg 481 acgcggtcaa catgttcacc agcatctact gtctgactgt gctcagcgtg gaccgctacg 541 tggccgtggt gcatcccatc aaggcggccc gctaccgccg gcccaccgtg gccaaggtag 601 taaacctggg cgtgtgggtg ctatcgctgc tcgtcatcct gcccatcgtg gtcttctctc 661 gcaccgcggc caacagcgac ggcacggtgg cttgcaacat gctcatgcca gagcccgctc 721 aacgctggct ggtgggcttc gtgttgtaca catttctcat gggcttcctg ctgcccgtgg 781 gggctatctg cctgtgctac gtgctcatca ttgctaagat gcgcatggtg gccctcaagg 841 ccggctggca gcagcgcaag cgctcggagc gcaagatcac cttaatggtg atgatggtgg 901 tgatggtgtt tgtcatctgc tggatgcctt tctacgtggt gcagctggtc aacgtgtttg 961 ctgagcagga cgacgccacg gtgagtcagc tgtcggtcaT CCTCGGCTAT GCCAACAGCT 1021 GCGCCAACCC CATCCTCTAT GGCTTTCTCT CAGACAACTT CAAGCGCTCT TTCCAACGCA 1081 TCCTATGCCT CAGCTGGATG GACAACGCCG CGGAGGAGCC GGTTGACTAT TACGCCACCG 1141 CGCTCAAGAG CCGTGCCTAC AGTGTGGAAG ACTTCCAACC TGAGAACCTG GAGTCCGGCG 1201 GCGTCTTCCG TAATGGCACC TGCACGTCCC GGATCACGAC GCTCTAGAAC CCAGCTTTCT 1261 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1321 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1381 GTGGAAAGGA CGAACACTAC CTACACCCTA GATAGCGACG CGTTAAGTCg acaatcaacc 1441 tctggattac aaaatttgtg aaagatt