Transcript: Mouse NM_009216.3

Mus musculus somatostatin receptor 1 (Sstr1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Sstr1 (20605)
Length:
3869
CDS:
426..1601

Additional Resources:

NCBI RefSeq record:
NM_009216.3
NBCI Gene record:
Sstr1 (20605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220312 CTTCCCAGAATGGGACCTTAA pLKO.1 559 CDS 100% 10.800 7.560 N Sstr1 n/a
2 TRCN0000358162 GACAACTTCAAGCGCTCTTTC pLKO_005 1407 CDS 100% 10.800 7.560 N SSTR1 n/a
3 TRCN0000220314 CCTGTCATTACTGGTTATCTT pLKO.1 974 CDS 100% 5.625 3.938 N Sstr1 n/a
4 TRCN0000220311 GCTACCAACATCTACATTCTA pLKO.1 699 CDS 100% 5.625 3.938 N Sstr1 n/a
5 TRCN0000220313 CCTGTGTTATGTGCTCATCAT pLKO.1 1145 CDS 100% 4.950 3.465 N Sstr1 n/a
6 TRCN0000220315 GCGTGCCCTTTCTGGTCACTT pLKO.1 754 CDS 100% 1.650 1.155 N Sstr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01601 pDONR223 100% 89.2% 98.7% None (many diffs) n/a
2 ccsbBroad304_01601 pLX_304 0% 89.2% 98.7% V5 (many diffs) n/a
3 TRCN0000467934 ATGTTTTCCGAATCAGGTGTGCTT pLX_317 42% 89.2% 98.7% V5 (many diffs) n/a
4 TRCN0000487734 ACACTACCTACACCCTAGATAGCG pLX_317 21.5% 89.2% 98.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489833 GGGCCTGATGCCTCTCACATGTAT pLX_317 34.6% 89.1% 98.4% V5 (many diffs) n/a
Download CSV