Construct: ORF TRCN0000487767
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021823.1_s317c1
- DNA Barcode:
- GTTTAGTTCAGGTGTCACGATACG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- P2RX7 (5027)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487767
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | NM_002562.6 | 99.8% | 99.6% | 463T>C;809G>A |
| 2 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | XM_011538419.3 | 82.4% | 82.1% | 0_1ins312;151T>C;497G>A |
| 3 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | XM_017019364.2 | 77.9% | 73.2% | (many diffs) |
| 4 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | XM_017019365.2 | 77.9% | 73.2% | (many diffs) |
| 5 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | XM_017019366.2 | 57.7% | 57.6% | 0_1ins753;56G>A |
| 6 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | XM_017019367.2 | 57.7% | 57.6% | 0_1ins753;56G>A |
| 7 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | XM_011538420.3 | 51.3% | 50.9% | (many diffs) |
| 8 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | NR_033951.2 | 34.3% | (many diffs) | |
| 9 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | NR_033949.2 | 33.9% | (many diffs) | |
| 10 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | NR_033948.2 | 33.4% | (many diffs) | |
| 11 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | NR_033954.2 | 32.9% | (many diffs) | |
| 12 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | NR_033952.2 | 32.9% | (many diffs) | |
| 13 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | NR_033955.2 | 32.2% | (many diffs) | |
| 14 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | NR_033953.2 | 31% | (many diffs) | |
| 15 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | NR_033950.2 | 30.7% | (many diffs) | |
| 16 | human | 5027 | P2RX7 | purinergic receptor P2X 7 | NR_033956.2 | 30.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1857
- ORF length:
- 1785
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgccggcc tgctgcagct gcagtgatgt tttccagtat gagacgaaca 121 aagtcactcg gatccagagc atgaattatg gcaccattaa gtggttcttc cacgtgatca 181 tcttttccta cgtttgcttt gctctggtga gtgacaagct gtaccagcgg aaagagcctg 241 tcatcagttc tgtgcacacc aaggtgaagg ggatagcaga ggtgaaagag gagatcgtgg 301 agaatggagt gaagaagttg gtgcacagtg tctttgacac cgcagactac accttccctt 361 tgcaggggaa ctctttcttc gtgatgacaa actttctcaa aacagaaggc caagagcagc 421 ggttgtgtcc cgagtatccc acccgcagga cgctctgttc ctctgaccga ggttgtaaaa 481 agggatggat ggacccgcag agcaaaggaa ttcagaccgg aaggtgtgta gtgcatgaag 541 ggaaccagaa gacctgtgaa gtctctgcct ggtgccccat cgaggcagtg gaagaggccc 601 cccggcctgc tctcttgaac agtgccgaaa acttcactgt gctcatcaag aacaatatcg 661 acttccccgg ccacaactac accacgagaa acatcctgcc aggtttaaac atcacttgta 721 ccttccacaa gactcagaat ccacagtgtc ccattttccg actaggagac atcttccgag 781 aaacaggcga taatttttca gatgtggcaa ttcagggcgg aataatgggc attgagatct 841 actgggactg caacctagac cgttggttcc atcactgcca tcccaaatac agtttccgtc 901 gccttgacga caagaccacc aacgtgtcct tgtaccctgg ctacaacttc agatacgcca 961 agtactacaa ggaaaacaat gttgagaaac ggactctgat aaaagtcttc gggatccgtt 1021 ttgacatcct ggtttttggc accggaggaa aatttgacat tatccagctg gttgtgtaca 1081 tcggctcaac cctctcctac ttcggtctgg ccgctgtgtt catcgacttc ctcatcgaca 1141 cttactccag taactgctgt cgctcccata tttatccctg gtgcaagtgc tgtcagccct 1201 gtgtggtcaa cgaatactac tacaggaaga agtgcgagtc cattgtggag ccaaagccga 1261 cattaaagta tgtgtccttt gtggatgaat cccacattag gatggtgaac cagcagctac 1321 tagggagaag tctgcaagat gtcaagggcc aagaagtccc aagacctgcg atggacttca 1381 cagatttgtc caggctgccc ctggccctcc atgacacacc cccgattcct ggacaaccag 1441 aggagataca gctgcttaga aaggaggcga ctcctagatc cagggatagc cccgtctggt 1501 gccagtgtgg aagctgcctc ccatctcaac tccctgagag ccacaggtgc ctggaggagc 1561 tgtgctgccg gaaaaagccg ggggcctgca tcaccaccTC AGAGCTGTTC AGGAAGCTGG 1621 TCCTGTCCAG ACACGTCCTG CAGTTCCTCC TGCTCTACCA GGAGCCCTTG CTGGCGCTGG 1681 ATGTGGATTC CACCAACAGC CGGCTGCGGC ACTGTGCCTA CAGGTGCTAC GCCACCTGGC 1741 GCTTCGGCTC CCAGGACATG GCTGACTTTG CCATCCTGCC CAGCTGCTGC CGCTGGAGGA 1801 TCCGGAAAGA GTTTCCGAAG AGTGAAGGGC AGTACAGTGG CTTCAAGAGT CCTTACTAGA 1861 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1921 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1981 TTTATATATC TTGTGGAAAG GACGAGTTTA GTTCAGGTGT CACGATACGA CGCGTTAAGT 2041 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt