Transcript: Human XM_011538420.3

PREDICTED: Homo sapiens purinergic receptor P2X 7 (P2RX7), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
P2RX7 (5027)
Length:
4668
CDS:
518..1438

Additional Resources:

NCBI RefSeq record:
XM_011538420.3
NBCI Gene record:
P2RX7 (5027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538420.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045094 CCGAGAAACAGGCGATAATTT pLKO.1 492 5UTR 100% 15.000 21.000 N P2RX7 n/a
2 TRCN0000045096 CAGTGGCTTCAAGAGTCCTTA pLKO.1 1414 CDS 100% 4.950 3.465 N P2RX7 n/a
3 TRCN0000045095 CGACTTCCTCATCGACACTTA pLKO.1 703 CDS 100% 4.950 3.465 N P2RX7 n/a
4 TRCN0000045093 GCATGAATTATGGCACCATTA pLKO.1 24 5UTR 100% 10.800 6.480 N P2RX7 n/a
5 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2429 3UTR 100% 4.950 2.475 Y CFLAR n/a
6 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2429 3UTR 100% 4.950 2.475 Y C19orf31 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3243 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3244 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2427 3UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2427 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2427 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538420.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487767 GTTTAGTTCAGGTGTCACGATACG pLX_317 14.9% 51.3% 50.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV