Construct: ORF TRCN0000487770
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021413.1_s317c1
- DNA Barcode:
- TTTTACTAGGTGCTGTGGCTATCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- EDNRB (1910)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487770
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1910 | EDNRB | endothelin receptor type B | NM_000115.5 | 99.8% | 100% | 552T>C;831A>G |
| 2 | human | 1910 | EDNRB | endothelin receptor type B | NM_001122659.3 | 99.8% | 100% | 552T>C;831A>G |
| 3 | human | 1910 | EDNRB | endothelin receptor type B | NM_003991.4 | 93.2% | 89.1% | (many diffs) |
| 4 | human | 1910 | EDNRB | endothelin receptor type B | NM_001201397.1 | 83% | 83% | 1_270del;1101A>G |
| 5 | mouse | 13618 | Ednrb | endothelin receptor type B | NM_001136061.2 | 85.1% | 88.7% | (many diffs) |
| 6 | mouse | 13618 | Ednrb | endothelin receptor type B | NM_001276296.1 | 85.1% | 88.7% | (many diffs) |
| 7 | mouse | 13618 | Ednrb | endothelin receptor type B | NM_007904.4 | 85.1% | 88.7% | (many diffs) |
| 8 | mouse | 13618 | Ednrb | endothelin receptor type B | XM_006518515.2 | 85.1% | 88.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 63
- ORF end:
- 1389
- ORF length:
- 1326
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaagcca 61 ccatgcagcc gcctccaagt ctgtgcggac gcgccctggt tgcgctggtt cttgcctgcg 121 gcctgtcgcg gatctgggga gaggagagag gcttcccgcc tgacagggcc actccgcttt 181 tgcaaaccgc agagataatg acgccaccca ctaagacctt atggcccaag ggttccaacg 241 ccagtctggc gcggtcgttg gcacctgcgg aggtgcctaa aggagacagg acggcaggat 301 ctccgccacg caccatctcc cctcccccgt gccaaggacc catcgagatc aaggagactt 361 tcaaatacat caacacggtt gtgtcctgcc ttgtgttcgt gctggggatc atcgggaact 421 ccacacttct gagaattatc tacaagaaca agtgcatgcg aaacggtccc aatatcttga 481 tcgccagctt ggctctggga gacctgctgc acatcgtcat tgacatccct atcaatgtct 541 acaagctgct ggcagaggac tggccatttg gagctgagat gtgtaagctg gtgcctttca 601 tacagaaagc ctccgtggga atcactgtgc tgagtctatg tgctctgagt attgacagat 661 atcgagctgt tgcttcttgg agtagaatta aaggaattgg ggttccaaaa tggacagcag 721 tagaaattgt tttgatttgg gtggtctctg tggttctggc tgtccctgaa gccataggtt 781 ttgatataat tacgatggac tacaaaggaa gttatctgcg aatctgcttg cttcatcccg 841 ttcagaagac agctttcatg cagttttaca agacagcaaa agattggtgg ctgttcagtt 901 tctatttctg cttgccattg gccatcactg cattttttta tacactaatg acctgtgaaa 961 tgttgagaaa gaaaagtggc atgcagattg ctttaaatga tcacctaaag cagagacggg 1021 aagtggccaa aaccgtcttt tgcctggtcc ttgtctttgc cctctgctgg cttccccttc 1081 acctcagcag gattctgaag ctcactcttt ataatcagaa tgatcccaat agatgtgaac 1141 ttttgagctt tctgttggta ttggactata ttggtatcaa catggcttca ctgaattcct 1201 gcattaaccc aattgctctg tatttggtga gcaaaagatt caaaaactgc tttaagtcat 1261 gcttatgctg ctggtgccag tcatttgaag aaaaacagtc cttGGAGGAA AAGCAGTCGT 1321 GCTTAAAGTT CAAAGCTAAT GATCACGGAT ATGACAACTT CCGTTCCAGT AATAAATACA 1381 GCTCATCTTA GGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1441 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1501 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATTT TACTAGGTGC TGTGGCTATC 1561 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t