Transcript: Mouse NM_001276296.1

Mus musculus endothelin receptor type B (Ednrb), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ednrb (13618)
Length:
2788
CDS:
226..1554

Additional Resources:

NCBI RefSeq record:
NM_001276296.1
NBCI Gene record:
Ednrb (13618)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001276296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027430 GCTCTAAGTATTGACAGATAT pLKO.1 805 CDS 100% 13.200 18.480 N Ednrb n/a
2 TRCN0000027447 CGCTCTGTATTTGGTGAGCAA pLKO.1 1377 CDS 100% 2.640 2.112 N Ednrb n/a
3 TRCN0000027465 CGGTATGCAGATTGCTTTGAA pLKO.1 1140 CDS 100% 5.625 3.938 N Ednrb n/a
4 TRCN0000027468 GCTGCTAAGAATCATCTACAA pLKO.1 588 CDS 100% 4.950 3.465 N Ednrb n/a
5 TRCN0000027486 GCAATAAATACAGCTCGTCTT pLKO.1 1532 CDS 100% 4.050 2.835 N Ednrb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06138 pDONR223 100% 85.1% 88.7% None (many diffs) n/a
2 ccsbBroad304_06138 pLX_304 0% 85.1% 88.7% V5 (many diffs) n/a
3 TRCN0000473186 ACTTGTCCAAAGGTGGCTCAATCG pLX_317 29.2% 85.1% 88.7% V5 (many diffs) n/a
4 TRCN0000488007 GGGCTGCCCGAGGAACCTTCATAC pLX_317 23.5% 85.1% 88.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487770 TTTTACTAGGTGCTGTGGCTATCG pLX_317 7.3% 85.1% 88.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489341 GATGTGAGCACCGAGTCCTTCTTA pLX_317 27.1% 85% 88.5% V5 (many diffs) n/a
Download CSV