Construct: ORF TRCN0000487777
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021332.1_s317c1
- DNA Barcode:
- CCCTTACCATTCAAGCTTTAGATT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PLCB2 (5330)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487777
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5330 | PLCB2 | phospholipase C beta 2 | NM_001284299.2 | 100% | 100% | |
| 2 | human | 5330 | PLCB2 | phospholipase C beta 2 | XM_017022319.2 | 17.4% | 17% | (many diffs) |
| 3 | human | 5330 | PLCB2 | phospholipase C beta 2 | NM_001284298.2 | 16.9% | 16.5% | (many diffs) |
| 4 | human | 5330 | PLCB2 | phospholipase C beta 2 | NM_001284297.2 | 16.7% | 16.4% | (many diffs) |
| 5 | human | 5330 | PLCB2 | phospholipase C beta 2 | NM_004573.3 | 16.7% | 16.3% | (many diffs) |
| 6 | human | 5330 | PLCB2 | phospholipase C beta 2 | XM_024449952.1 | 16.5% | 16.2% | (many diffs) |
| 7 | human | 5330 | PLCB2 | phospholipase C beta 2 | XM_024449951.1 | 16.5% | 16.2% | (many diffs) |
| 8 | human | 5330 | PLCB2 | phospholipase C beta 2 | XM_017022317.2 | 16.5% | 16.1% | (many diffs) |
| 9 | human | 5330 | PLCB2 | phospholipase C beta 2 | XM_024449950.1 | 16.4% | 16.1% | (many diffs) |
| 10 | human | 5330 | PLCB2 | phospholipase C beta 2 | XM_017022314.2 | 16.4% | 16% | (many diffs) |
| 11 | human | 5330 | PLCB2 | phospholipase C beta 2 | XM_024449949.1 | 16.3% | 16% | (many diffs) |
| 12 | human | 5330 | PLCB2 | phospholipase C beta 2 | XM_024449948.1 | 16.3% | 16% | (many diffs) |
| 13 | human | 5330 | PLCB2 | phospholipase C beta 2 | XR_001751315.2 | 12.8% | (many diffs) | |
| 14 | human | 5330 | PLCB2 | phospholipase C beta 2 | XR_001751317.2 | 12.4% | (many diffs) | |
| 15 | human | 5330 | PLCB2 | phospholipase C beta 2 | XR_001751316.2 | 12.3% | (many diffs) | |
| 16 | mouse | 18796 | Plcb2 | phospholipase C, beta 2 | XM_006498935.3 | 38.7% | 39% | (many diffs) |
| 17 | mouse | 18796 | Plcb2 | phospholipase C, beta 2 | XM_006498934.3 | 28.3% | 28.5% | (many diffs) |
| 18 | mouse | 18796 | Plcb2 | phospholipase C, beta 2 | XM_017316359.1 | 23.4% | 23.5% | (many diffs) |
| 19 | mouse | 18796 | Plcb2 | phospholipase C, beta 2 | NM_177568.2 | 14.8% | 14.9% | (many diffs) |
| 20 | mouse | 18796 | Plcb2 | phospholipase C, beta 2 | NM_001290790.1 | 13.1% | 13.1% | (many diffs) |
| 21 | mouse | 18796 | Plcb2 | phospholipase C, beta 2 | XM_017316357.1 | 10.6% | 10.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 669
- ORF length:
- 597
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtctctg ctcaaccctg tcctgctgcc ccccaaggtg aaggcctatc 121 tgagccaagg ggagcgcttc atcaaatggg atgatgaaac tacagttgcc tctccagtta 181 tcctccgtgt ggatcctaag ggctactact tatactggac gtatcaaagt aaggagatgg 241 agtttctgga tatcaccagc atccgggata ctcgctttgg gaagtttgcc aagatgccca 301 agagccagaa gctccgggac gtcttcaaca tggactttcc tgataacagt ttcctgctga 361 agacactcac ggtggtgtcc ggcccggaca tggtggacct caccTTCCAC AACTTCGTCT 421 CCTACAAGGA GAACGTGGGC AAGGCCTGGG CTGAGGACGT ACTGGCCCTA GTCAAACATC 481 CGCTGACGGC CAACGCCTCC CGCAGCACCT TCCTGGACAA GATCCTTGTG AAGCTCAAGA 541 TGCAGCTCAA CTCTGAAGGG AAGATTCCGG TGAAGAACTT TTTCCAGATG TTTCCTGCTG 601 ACCGCAAGCG GGTGGAAGCT GCTCTCAGTG CCTGCCACCT CCCCAAAGGC AAACCTGGAG 661 GAGCGAGATA GAACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 721 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 781 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACCC TTACCATTCA AGCTTTAGAT 841 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t