Construct: ORF TRCN0000487795
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020253.1_s317c1
- DNA Barcode:
- GTTGGATCTCCTAGATTATTCGTA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAPK15 (225689)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487795
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 225689 | MAPK15 | mitogen-activated protein k... | XM_011516928.2 | 71.3% | 68.7% | (many diffs) |
| 2 | human | 225689 | MAPK15 | mitogen-activated protein k... | NM_139021.3 | 46.2% | 46.3% | 285_286ins51;498C>T;781_1632del |
| 3 | human | 225689 | MAPK15 | mitogen-activated protein k... | XM_011516926.2 | 44.7% | 44.8% | (many diffs) |
| 4 | human | 225689 | MAPK15 | mitogen-activated protein k... | XM_017013218.1 | 44.1% | 40.7% | (many diffs) |
| 5 | human | 225689 | MAPK15 | mitogen-activated protein k... | XM_011516927.2 | 43.9% | 42.3% | (many diffs) |
| 6 | human | 225689 | MAPK15 | mitogen-activated protein k... | XM_011516925.2 | 42.4% | 41% | (many diffs) |
| 7 | human | 225689 | MAPK15 | mitogen-activated protein k... | XR_001745493.1 | 39.8% | (many diffs) | |
| 8 | human | 225689 | MAPK15 | mitogen-activated protein k... | XR_001745494.1 | 39.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 903
- ORF length:
- 831
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtgcacc gtagtggacc ctcgcattgt ccggagatac ctactcaggc 121 ggcagctcgg gcagggggcc tatggcattg tgtggaaggc agtggaccgg aggactggtg 181 aggtcgtggc catcaagaaa atctttgatg cttttaggga taagacagat gcccagagaa 241 cattccggga aatcacgctc ctccaggagt ttggggacca tcccaacatc atcagcctcc 301 ttgacgtgat ccgggcagag aacgacaggg acatttacct ggtgtttgag tttatgggtt 361 gcccccccag ccccccaccc ccgactgcag tgcgcaccct ctctgcagac actgacctga 421 acgcagtcat ccggaagggc ggcctgctgc aggacgtcca cgtgcgctcc atcttctacc 481 agctcctgcg ggccacccgg ttcctccact cggggcacgt tgtgcaccgg gaccagaagc 541 cgtccaatgt gctcctggat gccaactgca cagtgaagct gtgtgacttt ggcctggccc 601 gctccctggg cgacctccct gaggggcctg aggaccaggc cgtgacagag tacgtggcCA 661 CACGCTGGTA CCGAGCACCG GAGGTGCTGC TCTCTTCGCA CCGATACACC CTTGGGGTGG 721 ACATGTGGAG TCTGGGCTGT ATCCTGGGGG AGATGCTGCG GGGGAGACCC CTGTTCCCCG 781 GCACGTCCAC CCTCCACCAG CTGGAGCTGA TCCTGGAGAC CATCCCACCG CCATCTGAGG 841 AGGACCTCCT GGCTCTCGGC TCAGGCTGCC GTGCCTCTGT GCTGCACCAG CTGGGGTCCC 901 GGTGAGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 961 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1021 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGTTGGATCT CCTAGATTAT TCGTAACGCG 1081 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt