Construct: ORF TRCN0000487817
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020605.1_s317c1
- DNA Barcode:
- GGACCCAGTCAATTGCACAATCGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MARK2 (2011)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487817
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2011 | MARK2 | microtubule affinity regula... | NM_004954.5 | 100% | 100% | |
| 2 | human | 2011 | MARK2 | microtubule affinity regula... | NM_001163296.2 | 98.5% | 98.2% | (many diffs) |
| 3 | human | 2011 | MARK2 | microtubule affinity regula... | NM_001163297.2 | 97.9% | 97.9% | 1766_1767ins45 |
| 4 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544796.1 | 96.3% | 95.6% | (many diffs) |
| 5 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544795.1 | 96.2% | 95.5% | (many diffs) |
| 6 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544794.1 | 95.1% | 94.5% | (many diffs) |
| 7 | human | 2011 | MARK2 | microtubule affinity regula... | XM_017017311.1 | 95% | 94% | (many diffs) |
| 8 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544797.1 | 94.9% | 93.9% | (many diffs) |
| 9 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544798.1 | 94.3% | 93.6% | (many diffs) |
| 10 | human | 2011 | MARK2 | microtubule affinity regula... | NM_001039469.2 | 91.8% | 91.8% | 1234_1236delGCA;1512_1673del;1933_1959del |
| 11 | human | 2011 | MARK2 | microtubule affinity regula... | XM_017017310.1 | 91.1% | 91.1% | 1509_1670del;1928_1929ins45 |
| 12 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544791.1 | 89.8% | 89.2% | (many diffs) |
| 13 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544790.1 | 89.7% | 89.1% | (many diffs) |
| 14 | human | 2011 | MARK2 | microtubule affinity regula... | NM_017490.4 | 88.8% | 88.8% | 0_1ins99;1410_1571del |
| 15 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544789.1 | 88.7% | 88.1% | (many diffs) |
| 16 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544792.1 | 88.5% | 87.6% | (many diffs) |
| 17 | human | 2011 | MARK2 | microtubule affinity regula... | XM_011544793.1 | 87.8% | 87.2% | (many diffs) |
| 18 | human | 2011 | MARK2 | microtubule affinity regula... | XR_949801.2 | 80.6% | (many diffs) | |
| 19 | human | 2011 | MARK2 | microtubule affinity regula... | XR_949802.2 | 71.5% | 1_552del;2725_3035del | |
| 20 | human | 2011 | MARK2 | microtubule affinity regula... | XR_002957128.1 | 47% | (many diffs) | |
| 21 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | NM_001080388.2 | 92.5% | 97.9% | (many diffs) |
| 22 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | NM_001080389.2 | 91.4% | 96.7% | (many diffs) |
| 23 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526652.3 | 89.1% | 92.8% | (many diffs) |
| 24 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526654.3 | 88.9% | 92.4% | (many diffs) |
| 25 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_017318058.1 | 88.2% | 91.9% | (many diffs) |
| 26 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_017318059.1 | 88.1% | 93.3% | (many diffs) |
| 27 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | NM_007928.3 | 86.1% | 91.1% | (many diffs) |
| 28 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526648.3 | 83.1% | 86.6% | (many diffs) |
| 29 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526647.2 | 82.9% | 86.4% | (many diffs) |
| 30 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526650.3 | 82.8% | 86% | (many diffs) |
| 31 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | NM_001080390.2 | 82% | 86.8% | (many diffs) |
| 32 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_011247139.1 | 80% | 84.9% | (many diffs) |
| 33 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526643.2 | 79.5% | 84.1% | (many diffs) |
| 34 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526642.3 | 78.5% | 81.8% | (many diffs) |
| 35 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526641.3 | 77.7% | 80.9% | (many diffs) |
| 36 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526644.3 | 75.6% | 80.1% | (many diffs) |
| 37 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526645.2 | 75.6% | 80.1% | (many diffs) |
| 38 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526646.3 | 75.6% | 80.1% | (many diffs) |
| 39 | mouse | 13728 | Mark2 | MAP/microtubule affinity re... | XM_006526656.3 | 72.3% | 72.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2244
- ORF length:
- 2172
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtccagc gctcggaccc ccctacccac gctgaacgag agggacacgg 121 agcagcccac cttgggacac cttgactcca agcccagcag taagtccaac atgattcggg 181 gccgcaactc agccacctct gctgatgagc agccccacat tggaaactac cggctcctca 241 agaccattgg caagggtaat tttgccaagg tgaagttggc ccgacacatc ctgactggga 301 aagaggtagc tgtgaagatc attgacaaga ctcaactgaa ctcctccagc ctccagaaac 361 tattccgcga agtaagaata atgaaggttt tgaatcatcc caacatagtt aaattatttg 421 aagtgattga gactgagaaa acgctctacc ttgtcatgga gtacgctagt ggcggagagg 481 tatttgatta cctagtggct catggcagga tgaaagaaaa agaggctcga gccaaattcc 541 gccagatagt gtctgctgtg cagtactgtc accagaagtt tattgtccat agagacttaa 601 aggcagaaaa cctgctcttg gatgctgata tgaacatcaa gattgcagac tttggcttca 661 gcaatgaatt cacctttggg aacaagctgg acaccttctg tggcagtccc ccttatgctg 721 ccccagaact cttccagggc aaaaaatatg atggacccga ggtggatgtg tggagcctag 781 gagttatcct ctatacactg gtcagcggat ccctgccttt tgatggacag aacctcaagg 841 agctgcggga acgggtactg aggggaaaat accgtattcc attctacatg tccacggact 901 gtgaaaacct gcttaagaaa tttctcattc ttaatcccag caagagaggc actttagagc 961 aaatcatgaa agatcgatgg atgaatgtgg gtcacgaaga tgatgaacta aagccttacg 1021 tggagccact ccctgactac aaggaccccc ggcggacaga gctgatggtg tccatgggtt 1081 atacacggga agagatccag gactcgctgg tgggccagag atacaacgag gtgatggcca 1141 cctatctgct cctgggctac aagagctccg agctggaagg cgacaccatc accctgaaac 1201 cccggccttc agctgatctg accaatagca gcgccccatc cccatcccac aaggtacagc 1261 gcagcgtgtc ggccaatccc aagcagcggc gcttcagcga ccaggctggt cctgccattc 1321 ccacctctaa ttcttactct aagaagactc agagtaacaa cgcagaaaat aagcggcctg 1381 aggaggaccg ggagtcaggg cggaaagcca gcagcacagc caaggtgcct gccagccccc 1441 tgcccggtct ggagaggaag aagaccaccc caaccccctc cacgaacagc gtcctctcca 1501 ccagcacaaa tcgaagcagg aattccccac ttttggagcg ggccagcctc ggccaggcct 1561 ccatccagaa tggcaaagac agcacagccc cccagcgtgt ccctgttgcc tccccatccg 1621 cccacaacat cagcagcagt ggtggagccc cagaccgaac taacttcccc cggggtgtgt 1681 ccagccgaag caccttccat gctgggcagc tccgacaggt gcgggaccag cagaatttgc 1741 cctacggtgt gaccccagcc tctccctctg gccacagcca gggccggcgg ggggcctctg 1801 ggagcatctt cagcaagttc acctccaagt ttgtacgcag gaacctgaat gaacctgaaa 1861 gcaaagaccg agtggagacg ctcagacctc acgtggtggg cagtggcggc aacgacaaag 1921 aaaaggaaga atttcgggag gccaagcccc gctcccTCCG CTTCACGTGG AGTATGAAGA 1981 CCACGAGCTC CATGGAGCCC AACGAGATGA TGCGGGAGAT CCGCAAGGTG CTGGACGCGA 2041 ACAGCTGCCA GAGCGAGCTG CATGAGAAGT ACATGCTGCT GTGCATGCAC GGCACGCCGG 2101 GCCACGAGGA CTTCGTGCAG TGGGAGATGG AGGTGTGCAA ACTGCCGCGG CTCTCTCTCA 2161 ACGGGGTTCG ATTTAAGCGG ATATCGGGCA CCTCCATGGC CTTCAAAAAC ATTGCCTCCA 2221 AAATAGCCAA CGAGCTGAAG CTTTAGAACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 2281 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 2341 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGGACCCAG 2401 TCAATTGCAC AATCGAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 2461 aagatt