Transcript: Human NM_017490.4

Homo sapiens microtubule affinity regulating kinase 2 (MARK2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
MARK2 (2011)
Length:
4494
CDS:
474..2711

Additional Resources:

NCBI RefSeq record:
NM_017490.4
NBCI Gene record:
MARK2 (2011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017490.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320492 TGATGGTGTCCATGGGTTATA pLKO_005 1366 CDS 100% 13.200 18.480 N MARK2 n/a
2 TRCN0000001581 TGCACAGAGTATTTCGCCTAA pLKO.1 3006 3UTR 100% 4.050 5.670 N MARK2 n/a
3 TRCN0000320490 TGCACAGAGTATTTCGCCTAA pLKO_005 3006 3UTR 100% 4.050 5.670 N MARK2 n/a
4 TRCN0000320417 GACCATTGGCAAGGGTAATTT pLKO_005 545 CDS 100% 15.000 10.500 N MARK2 n/a
5 TRCN0000380393 TGCCATTCCCACCTCTAATTC pLKO_005 1616 CDS 100% 13.200 9.240 N MARK2 n/a
6 TRCN0000321809 TGCGGTTGCACAGAGTATTTC pLKO_005 3000 3UTR 100% 13.200 9.240 N Mark2 n/a
7 TRCN0000001583 GTGGCGGAGAGGTATTTGATT pLKO.1 772 CDS 100% 5.625 3.938 N MARK2 n/a
8 TRCN0000320415 GTGGCGGAGAGGTATTTGATT pLKO_005 772 CDS 100% 5.625 3.938 N MARK2 n/a
9 TRCN0000001584 AGATGATGAACTAAAGCCTTA pLKO.1 1301 CDS 100% 4.050 2.835 N MARK2 n/a
10 TRCN0000320416 AGATGATGAACTAAAGCCTTA pLKO_005 1301 CDS 100% 4.050 2.835 N MARK2 n/a
11 TRCN0000001585 TGGGTTATACACGGGAAGAGA pLKO.1 1378 CDS 100% 3.000 2.100 N MARK2 n/a
12 TRCN0000001582 CACCAGAAGTTTATTGTCCAT pLKO.1 873 CDS 100% 2.640 1.848 N MARK2 n/a
13 TRCN0000220661 CCTGAATGAACCTGAAAGCAA pLKO.1 2309 CDS 100% 3.000 1.800 N Mark2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017490.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487817 GGACCCAGTCAATTGCACAATCGA pLX_317 13.6% 88.8% 88.8% V5 (not translated due to prior stop codon) 0_1ins99;1410_1571del n/a
2 ccsbBroadEn_14624 pDONR223 73.6% 88.5% 88.3% None (many diffs) n/a
3 ccsbBroad304_14624 pLX_304 0% 88.5% 88.3% V5 (many diffs) n/a
4 TRCN0000473546 TTATGTTGTAGCAGATTTATTTAA pLX_317 18.6% 88.5% 88.3% V5 (many diffs) n/a
Download CSV