Construct: ORF TRCN0000487858
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021891.1_s317c1
- DNA Barcode:
- TGCGGACGGCCTCTATATGGGTCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- TDGF1 (6997)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487858
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6997 | TDGF1 | teratocarcinoma-derived gro... | NM_003212.4 | 100% | 100% | |
| 2 | human | 6997 | TDGF1 | teratocarcinoma-derived gro... | NM_001174136.2 | 91.4% | 91.4% | 0_1ins48 |
| 3 | human | 6998 | TDGF1P3 | teratocarcinoma-derived gro... | NR_002718.2 | 20.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 633
- ORF length:
- 564
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggactgcagg aagatggccc gcttctctta cagtgtgatt tggatcatgg 121 ccatttctaa agtctttgaa ctgggattag ttgccgggct gggccatcag gaatttgctc 181 gtccatctcg gggatacctg gccttcagag atgacagcat ttggccccag gaggagcctg 241 caattcggcc tcggtcttcc cagcgtgtgc cgcccatggg gatacagcac agtaaggagc 301 taaacagaac ctgctgcctg aatgggggaa cctgcatgct ggggtccttt tgtgcctgcc 361 ctccctccTT CTACGGACGG AACTGTGAGC ACGATGTGCG CAAAGAGAAC TGTGGGTCTG 421 TGCCCCATGA CACCTGGCTG CCCAAGAAGT GTTCCCTGTG TAAATGCTGG CACGGTCAGC 481 TCCGCTGCTT TCCTCAGGCA TTTCTACCCG GCTGTGATGG CCTTGTGATG GATGAGCACC 541 TCGTGGCTTC CAGGACTCCA GAACTACCAC CGTCTGCACG TACTACCACT TTTATGCTAG 601 TTGGCATCTG CCTTTCTATA CAAAGCTACT ATTAGAACCC AGCTTTCTTG TACAAAGTGG 661 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 721 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 781 ATGCGGACGG CCTCTATATG GGTCCACGCG TTAAGTCgac aatcaacctc tggattacaa 841 aatttgtgaa agatt