Construct: ORF TRCN0000487968
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020763.1_s317c1
- DNA Barcode:
- TTCCTCTGCTACCCATACGGTGAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PROKR1 (10887)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487968
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10887 | PROKR1 | prokineticin receptor 1 | NM_138964.3 | 99.9% | 100% | 945G>A |
| 2 | human | 128674 | PROKR2 | prokineticin receptor 2 | NM_144773.3 | 82.4% | 84.9% | (many diffs) |
| 3 | human | 128674 | PROKR2 | prokineticin receptor 2 | XM_017027646.1 | 82.4% | 84.9% | (many diffs) |
| 4 | mouse | 58182 | Prokr1 | prokineticin receptor 1 | XM_006506433.3 | 58.8% | 60% | (many diffs) |
| 5 | mouse | 246313 | Prokr2 | prokineticin receptor 2 | XM_011239558.2 | 46.7% | 48.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1251
- ORF length:
- 1179
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggagacc accatggggt tcatggatga caatgccacc aacacttcca 121 ccagcttcct ttctgtgctc aaccctcatg gagcccatgc cacttccttc ccattcaact 181 tcagctacag cgactatgat atgcctttgg atgaagatga ggatgtgacc aattccagga 241 cgttctttgc tgccaagatt gtcattggga tggccctggt gggcatcatg ctggtctgcg 301 gcattggaaa cttcatcttt atcgctgccc tggtccgcta caagaaactg cgcaacctca 361 ccaacctgct catcgccaac ctggccatct ctgacttcct ggtggccatt gtctgctgcc 421 cctttgagat ggactactat gtggtgcgcc agctctcctg ggagcacggc cacgtcctgt 481 gcacctctgt caactacctg cgcactgtct ctctctatgt ctccaccaat gccctgctgg 541 ccatcgccat tgacaggtat ctggctattg tccatccgct gagaccacgg atgaagtgcc 601 aaacagccac tggcctgatt gccttggtgt ggacggtgtc catcctgatc gccatccctt 661 ccgcctactt caccaccgag acggtcctcg tcattgtcaa gagccaggaa aagatcttct 721 gcggccagat ctggcctgtg gaccagcagc tctactacaa gtcctacttc ctctttatct 781 ttggcataga attcgtgggc cccgtggtca ccatgaccct gtgctatgcc aggatctccc 841 gggagctctg gttcaaggcg gtccctggat tccagacaga gcagatccgc aagaggctgc 901 gctgccgcag gaagacggtc ctggtgctca tgtgcatcct caccgcctac gtgctatgct 961 gggcgcccTT CTACGGCTTC ACCATCGTGC GCGACTTCTT CCCCACCGTG TTTGTAAAGG 1021 AGAAGCACTA CCTCACTGCC TTCTACATCG TCGAGTGCAT CGCCATGAGC AACAGCATGA 1081 TCAACACTCT GTGCTTCGTG ACCGTCAAGA ACGACACCGT CAAGTACTTC AAAAAGATCA 1141 TGTTGCTCCA CTGGAAGGCT TCTTACAATG GCGGTAAGTC CAGTGCAGAC CTGGACCTCA 1201 AGACAATTGG GATGCCTGCC ACCGAAGAGG TGGACTGCAT CAGACTAAAA TAAGACCCAG 1261 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1321 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1381 TATCTTGTGG AAAGGACGAT TCCTCTGCTA CCCATACGGT GACACGCGTT AAGTCgacaa 1441 tcaacctctg gattacaaaa tttgtgaaag att