Construct: ORF TRCN0000488007
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020915.1_s317c1
- DNA Barcode:
- GGGCTGCCCGAGGAACCTTCATAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- EDNRB (1910)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488007
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1910 | EDNRB | endothelin receptor type B | NM_000115.5 | 99.8% | 100% | 552T>C;831A>G |
2 | human | 1910 | EDNRB | endothelin receptor type B | NM_001122659.3 | 99.8% | 100% | 552T>C;831A>G |
3 | human | 1910 | EDNRB | endothelin receptor type B | NM_003991.4 | 93.2% | 89.1% | (many diffs) |
4 | human | 1910 | EDNRB | endothelin receptor type B | NM_001201397.1 | 83% | 83% | 1_270del;1101A>G |
5 | mouse | 13618 | Ednrb | endothelin receptor type B | NM_001136061.2 | 85.1% | 88.7% | (many diffs) |
6 | mouse | 13618 | Ednrb | endothelin receptor type B | NM_001276296.1 | 85.1% | 88.7% | (many diffs) |
7 | mouse | 13618 | Ednrb | endothelin receptor type B | NM_007904.4 | 85.1% | 88.7% | (many diffs) |
8 | mouse | 13618 | Ednrb | endothelin receptor type B | XM_006518515.2 | 85.1% | 88.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1398
- ORF length:
- 1326
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcagccg cctccaagtc tgtgcggacg cgccctggtt gcgctggttc 121 ttgcctgcgg cctgtcgcgg atctggggag aggagagagg cttcccgcct gacagggcca 181 ctccgctttt gcaaaccgca gagataatga cgccacccac taagacctta tggcccaagg 241 gttccaacgc cagtctggcg cggtcgttgg cacctgcgga ggtgcctaaa ggagacagga 301 cggcaggatc tccgccacgc accatctccc ctcccccgtg ccaaggaccc atcgagatca 361 aggagacttt caaatacatc aacacggttg tgtcctgcct tgtgttcgtg ctggggatca 421 tcgggaactc cacacttctg agaattatct acaagaacaa gtgcatgcga aacggtccca 481 atatcttgat cgccagcttg gctctgggag acctgctgca catcgtcatt gacatcccta 541 tcaatgtcta caagctgctg gcagaggact ggccatttgg agctgagatg tgtaagctgg 601 tgcctttcat acagaaagcc tccgtgggaa tcactgtgct gagtctatgt gctctgagta 661 ttgacagata tcgagctgtt gcttcttgga gtagaattaa aggaattggg gttccaaaat 721 ggacagcagt agaaattgtt ttgatttggg tggtctctgt ggttctggct gtccctgaag 781 ccataggttt tgatataatt acgatggact acaaaggaag ttatctgcga atctgcttgc 841 ttcatcccgt tcagaagaca gctttcatgc agttttacaa gacagcaaaa gattggtggc 901 tgttcagttt ctatttctgc ttgccattgg ccatcactgc atttttttat acactaatga 961 cctgtgaaat gttgagaaag aaaagtggca tgcagattgc tttaaatgat cacctaaagc 1021 agagacggga agtggccaaa accgtctttt gcctggtcct tgtctttgcc ctctgctggc 1081 ttccccttca ccTCAGCAGG ATTCTGAAGC TCACTCTTTA TAATCAGAAT GATCCCAATA 1141 GATGTGAACT TTTGAGCTTT CTGTTGGTAT TGGACTATAT TGGTATCAAC ATGGCTTCAC 1201 TGAATTCCTG CATTAACCCA ATTGCTCTGT ATTTGGTGAG CAAAAGATTC AAAAACTGCT 1261 TTAAGTCATG CTTATGCTGC TGGTGCCAGT CATTTGAAGA AAAACAGTCC TTGGAGGAAA 1321 AGCAGTCGTG CTTAAAGTTC AAAGCTAATG ATCACGGATA TGACAACTTC CGTTCCAGTA 1381 ATAAATACAG CTCATCTTAG GACCCAGCTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1441 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1501 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGGGC TGCCCGAGGA 1561 ACCTTCATAC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt