Construct: ORF TRCN0000488083
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019412.1_s317c1
- DNA Barcode:
- AATGACAATCCACGGTCATACCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HRH2 (3274)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488083
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3274 | HRH2 | histamine receptor H2 | XM_006714865.3 | 99.1% | 99.1% | 1078_1086delAACTCTTCAinsG |
| 2 | human | 3274 | HRH2 | histamine receptor H2 | NM_001131055.2 | 90.5% | 90.4% | 1077_1081delACCAT;1084_1191del |
| 3 | human | 3274 | HRH2 | histamine receptor H2 | NM_001367711.1 | 85% | 85% | 1078_1266delinsG |
| 4 | human | 3274 | HRH2 | histamine receptor H2 | XM_006714864.4 | 85% | 85% | 1078_1266delinsG |
| 5 | human | 3274 | HRH2 | histamine receptor H2 | XM_011534548.3 | 85% | 85% | 1078_1266delinsG |
| 6 | human | 3274 | HRH2 | histamine receptor H2 | XM_011534549.3 | 85% | 85% | 1078_1266delinsG |
| 7 | human | 3274 | HRH2 | histamine receptor H2 | XM_017009426.2 | 85% | 85% | 1078_1266delinsG |
| 8 | human | 3274 | HRH2 | histamine receptor H2 | NR_160284.1 | 22.4% | 1_610del;1687A>G;1689_4800del | |
| 9 | mouse | 15466 | Hrh2 | histamine receptor H2 | NM_008286.2 | 83.8% | 85.2% | (many diffs) |
| 10 | mouse | 15466 | Hrh2 | histamine receptor H2 | XM_006516853.3 | 81.1% | 83% | (many diffs) |
| 11 | mouse | 15466 | Hrh2 | histamine receptor H2 | NM_001010973.2 | 75.7% | 77.1% | (many diffs) |
| 12 | mouse | 15466 | Hrh2 | histamine receptor H2 | XM_006516852.2 | 75.7% | 77.1% | (many diffs) |
| 13 | mouse | 15466 | Hrh2 | histamine receptor H2 | XM_017315397.1 | 75.7% | 77.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1155
- ORF length:
- 1080
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatggca cccaatggca cagcctcttc cttttgcctg gactctaccg 121 catgcaagat caccatcacc gtggtccttg cggtcctcat cctcatcacc gttgctggca 181 atgtggtcgt ctgtctggcc gtgggcttga accgccggct ccgcaacctg accaattgtt 241 tcatcgtgtc cttggctatc actgacctgc tcctcggcct cctggtgctg cccttctctg 301 ccatctacca gctgtcctgc aagtggagct ttggcaaggt cttctgcaat atctacacca 361 gcctggatgt gatgctctgc acagcctcca ttcttaacct cttcatgatc agcctcgacc 421 ggtactgcgc tgtcatggac ccactgcggt accctgtgct ggtcacccca gttcgggtcg 481 ccatctctct ggtcttaatt tgggtcatct ccattaccct gtcctttctg tctatccacc 541 tggggtggaa cagcaggaac gagaccagca agggcaatca taccacctct aagtgcaaag 601 tccaggtcaa tgaagtgtac gggctggtgg atgggctggt caccttctac ctcccgctac 661 tgatcatgtg catcacctac taccgcatct tcaaggtcgc ccgggatcag gccaagagga 721 tcaatcacat tagctcctgg aaggcagcca ccatcaggga gcacaaagcc acagtgacac 781 tggccgccgt catgggggcc ttcatcatct gctggtttcc ctacttcacc gcgtttgtgt 841 accgtgggcT GAGAGGGGAT GATGCCATCA ATGAGGTGTT AGAAGCCATC GTTCTGTGGC 901 TGGGCTATGC CAACTCAGCC CTGAACCCCA TCCTGTATGC TGCGCTGAAC AGAGACTTCC 961 GCACCGGGTA CCAACAGCTC TTCTGCTGCA GGCTGGCCAA CCGCAACTCC CACAAAACTT 1021 CTCTGAGGTC CAACGCCTCT CAGCTGTCCA GGACCCAAAG CCGAGAACCC AGGCAACAGG 1081 AAGAGAAACC CCTGAAGCTC CAGGTGTGGA GTGGGACAGA AGTCACGGCC CCCCAGGGAG 1141 CCACAGACAG GGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1201 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1261 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAAAT GACAATCCAC GGTCATACCG 1321 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t