Transcript: Human XM_017009426.2

PREDICTED: Homo sapiens histamine receptor H2 (HRH2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HRH2 (3274)
Length:
5076
CDS:
1057..2325

Additional Resources:

NCBI RefSeq record:
XM_017009426.2
NBCI Gene record:
HRH2 (3274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009066 GCCATCAATGAGGTGTTAGAA pLKO.1 1846 CDS 100% 5.625 4.500 N HRH2 n/a
2 TRCN0000009069 GCCATCTCTCTGGTCTTAATT pLKO.1 1462 CDS 100% 15.000 10.500 N HRH2 n/a
3 TRCN0000378345 ATCAGGCCAAGAGGATCAATC pLKO_005 1688 CDS 100% 10.800 7.560 N HRH2 n/a
4 TRCN0000378363 GACCAGCAAGGGCAATCATAC pLKO_005 1545 CDS 100% 10.800 7.560 N HRH2 n/a
5 TRCN0000009068 CCGCAACCTGACCAATTGTTT pLKO.1 1203 CDS 100% 5.625 3.938 N HRH2 n/a
6 TRCN0000009067 GCCAAGAGGATCAATCACATT pLKO.1 1693 CDS 100% 4.950 3.465 N HRH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00788 pDONR223 100% 86.9% 82.9% None (many diffs) n/a
2 ccsbBroad304_00788 pLX_304 0% 86.9% 82.9% V5 (many diffs) n/a
3 TRCN0000475601 GATTTCCGGTGCCTGGTGGAGGCA pLX_317 12.6% 86.9% 82.9% V5 (many diffs) n/a
4 TRCN0000488083 AATGACAATCCACGGTCATACCGC pLX_317 28.3% 85% 85% V5 1078_1266delinsG n/a
Download CSV