Construct: ORF TRCN0000488086
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021782.1_s317c1
- DNA Barcode:
- ACTTGAGCCAGATAGATTTAAAAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GRB2 (2885)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488086
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2885 | GRB2 | growth factor receptor boun... | NM_002086.5 | 100% | 100% | |
| 2 | human | 2885 | GRB2 | growth factor receptor boun... | NM_203506.2 | 81.1% | 81.1% | 176_177ins123 |
| 3 | mouse | 14784 | Grb2 | growth factor receptor boun... | NM_001313936.1 | 92.1% | 99.5% | (many diffs) |
| 4 | mouse | 14784 | Grb2 | growth factor receptor boun... | NM_001313937.1 | 92.1% | 99.5% | (many diffs) |
| 5 | mouse | 14784 | Grb2 | growth factor receptor boun... | NM_008163.4 | 92.1% | 99.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 723
- ORF length:
- 651
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggaagcc atcgccaaat atgacttcaa agctactgca gacgacgagc 121 tgagcttcaa aaggggggac atcctcaagg ttttgaacga agaatgtgat cagaactggt 181 acaaggcaga gcttaatgga aaagacggct tcattcccaa gaactacata gaaatgaaac 241 cacatccgtg gttttttggc aaaatcccca gagccaaggc agaagaaatg cttagcaaac 301 agcggcacga tggggccttt cttatccgag agagtgagag cgctcctggg gacttctccc 361 tctctgtcaa gtttggaaac gatgtgcagc acttcaaggt gctccgagat GGAGCCGGGA 421 AGTACTTCCT CTGGGTGGTG AAGTTCAATT CTTTGAATGA GCTGGTGGAT TATCACAGAT 481 CTACATCTGT CTCCAGAAAC CAGCAGATAT TCCTGCGGGA CATAGAACAG GTGCCACAGC 541 AGCCGACATA CGTCCAGGCC CTCTTTGACT TTGATCCCCA GGAGGATGGA GAGCTGGGCT 601 TCCGCCGGGG AGATTTTATC CATGTCATGG ATAACTCAGA CCCCAACTGG TGGAAAGGAG 661 CTTGCCACGG GCAGACCGGC ATGTTTCCCC GCAATTATGT CACCCCCGTG AACCGGAACG 721 TCTAGAACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 781 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 841 CTTGGCTTTA TATATCTTGT GGAAAGGACG AACTTGAGCC AGATAGATTT AAAATACGCG 901 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt