Transcript: Mouse NM_001313936.1

Mus musculus growth factor receptor bound protein 2 (Grb2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Grb2 (14784)
Length:
2550
CDS:
157..810

Additional Resources:

NCBI RefSeq record:
NM_001313936.1
NBCI Gene record:
Grb2 (14784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097111 TGGTAGATTACCACAGATCAA pLKO.1 548 CDS 100% 4.950 6.930 N Grb2 n/a
2 TRCN0000308364 TGGTAGATTACCACAGATCAA pLKO_005 548 CDS 100% 4.950 6.930 N Grb2 n/a
3 TRCN0000097112 CATGTCATGGATAACTCAGAT pLKO.1 706 CDS 100% 4.950 3.465 N Grb2 n/a
4 TRCN0000308434 CATGTCATGGATAACTCAGAT pLKO_005 706 CDS 100% 4.950 3.465 N Grb2 n/a
5 TRCN0000097113 CAGAACTGGTATAAGGCAGAA pLKO.1 256 CDS 100% 4.050 2.835 N Grb2 n/a
6 TRCN0000308435 CAGAACTGGTATAAGGCAGAA pLKO_005 256 CDS 100% 4.050 2.835 N Grb2 n/a
7 TRCN0000097110 GCAGATATTCTTACGGGACAT pLKO.1 588 CDS 100% 4.050 2.835 N Grb2 n/a
8 TRCN0000308438 GCAGATATTCTTACGGGACAT pLKO_005 588 CDS 100% 4.050 2.835 N Grb2 n/a
9 TRCN0000097109 GCATGATGTTTAAGGCCACAT pLKO.1 1095 3UTR 100% 4.050 2.835 N Grb2 n/a
10 TRCN0000308437 GCATGATGTTTAAGGCCACAT pLKO_005 1095 3UTR 100% 4.050 2.835 N Grb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00688 pDONR223 100% 92.1% 99.5% None (many diffs) n/a
2 TRCN0000474536 ACTTCTCGATTAAGGTGTTACTTA pLX_317 86.2% 92.1% 99.5% V5 (many diffs) n/a
3 TRCN0000488086 ACTTGAGCCAGATAGATTTAAAAT pLX_317 47.9% 92.1% 99.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV