Construct: ORF TRCN0000488157
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021099.1_s317c1
- DNA Barcode:
- CTTCATGAAATTTCCGTACAGCCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GLP1R (2740)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488157
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | NM_002062.5 | 99.7% | 99.7% | (many diffs) |
| 2 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | XM_017010750.1 | 94% | 93.4% | (many diffs) |
| 3 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | XR_001743348.1 | 64% | (many diffs) | |
| 4 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | XM_017010751.1 | 56.1% | 53.5% | (many diffs) |
| 5 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | XR_001743347.1 | 42.5% | (many diffs) | |
| 6 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | XR_001743346.1 | 41.8% | (many diffs) | |
| 7 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | NR_136562.2 | 25.3% | (many diffs) | |
| 8 | human | 2740 | GLP1R | glucagon like peptide 1 rec... | NR_136563.2 | 21.2% | (many diffs) | |
| 9 | mouse | 14652 | Glp1r | glucagon-like peptide 1 rec... | NM_021332.2 | 87.4% | 92.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1461
- ORF length:
- 1389
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggccggc gcccccggcc cgctgcgcct tgcgctgctg ctgctcggga 121 tggtgggcag ggccggcccc cgcccccagg gtgccactgt gtccctctgg gagacggtgc 181 agaaatggcg agaataccga cgccagtgcc agcgctccct gactgaggat ccacctcctg 241 ccacagactt gttctgcaac cggaccttcg atgaatacgc ctgctggcca gatggggagc 301 caggctcgtt cgtgaatgtc agctgcccct ggtacctgcc ctgggccagc agtgtgccgc 361 agggccacgt gtaccggttc tgcacagctg aaggcctctg gctgcagaag gacaactcca 421 gcctgccctg gagggacttg tcggagtgcg aggagtccaa gcgaggggag agaagctccc 481 cggaggagca gctcctgttc ctctacatca tctacacggt gggctacgca ctctccttct 541 ctgctctggt tatcgcctct gcgatcctcc tcggcttcag acacctgcac tgcacccgga 601 actacatcca cctgaacctg tttgcatcct tcatcctgcg agcattgtcc gtcttcatca 661 aggacgcagc cctgaagtgg atgtatagca cagccgccca gcagcaccag tgggatgggc 721 tcctctccta ccaggactct ctgagctgcc gcctggtgtt tctgctcatg cagtactgtg 781 tggcggccaa ttactactgg ctcttggtgg agggcgtgta cctgtacaca ctgctggcct 841 tctcggtctt ctctgagcaa tggatcttca ggctctacgt gagcataggc tggggtgttc 901 ccctgctgtt tgttgtcccc tggggcattg tcaagtacct ctatgaggac gagggctgct 961 ggaccaggaa ctccaacatg aactactggc tcattatccg gctgcccatt ctctttgcca 1021 ttggggtgaa cttcctcatc tttgttcggg tcatctgcat cgtggtatcc aaactgaagg 1081 ccaatctcat gtgcaagaca gacatcaaat gcagacttgc caagtccacg ctgacactca 1141 tccccctgct ggGGACTCAT GAGGTCATCT TTGCCTTTGT GATGGACGAG CACGCCCGGG 1201 GGACCCTGCG CTTCATCAAG CTGTTTACAG AGCTCTCCTT CACCTCCTTC CAGGGGCTGA 1261 TGGTGGCCAT CTTATACTGC TTTGTCAACA ATGAGGTCCA GCTGGAATTT CGGAAGAGCT 1321 GGGAGCGCTG GCGGCTTGAG CACTTGCACA TCCAGAGGGA CAGCAGCATG AAGCCCCTCA 1381 AGTGTCCCAC CAGCAGCCTG AGCAGTGGAG CCACGGCGGG CAGCAGCATG TACACAGCCA 1441 CTTGCCAGGC CTCCTGCAGC TGAGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1501 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGCCCGTAAC 1561 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC TTCATGAAAT 1621 TTCCGTACAG CCGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1681 att