Transcript: Human XR_001743348.1

PREDICTED: Homo sapiens glucagon like peptide 1 receptor (GLP1R), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLP1R (2740)
Length:
2131
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743348.1
NBCI Gene record:
GLP1R (2740)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356346 TGCGCTTCATCAAGCTGTTTA pLKO_005 1731 3UTR 100% 13.200 18.480 N GLP1R n/a
2 TRCN0000356418 CAACCGGACCTTCGATGAATA pLKO_005 781 3UTR 100% 13.200 10.560 N GLP1R n/a
3 TRCN0000356343 TGCTGGCCTTCTCGGTCTTAT pLKO_005 1356 3UTR 100% 13.200 9.240 N GLP1R n/a
4 TRCN0000004706 CCTCATCTTTGTTCGGGTCAT pLKO.1 1558 3UTR 100% 4.050 2.835 N GLP1R n/a
5 TRCN0000004709 CCTGAACCTGTTTGCATCCTT pLKO.1 1135 3UTR 100% 3.000 2.100 N GLP1R n/a
6 TRCN0000004707 CGGTGCAGAAATGGCGAGAAT pLKO.1 699 3UTR 100% 4.950 2.970 N GLP1R n/a
7 TRCN0000004708 CTGCGCTTCATCAAGCTGTTT pLKO.1 1730 3UTR 100% 4.950 2.970 N GLP1R n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488946 GGAGTTACGCAAGGCTCATTATTA pLX_317 22.4% 64% V5 (many diffs) n/a
2 TRCN0000488157 CTTCATGAAATTTCCGTACAGCCG pLX_317 22.7% 64% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV