Construct: ORF TRCN0000488168
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF022024.1_s317c1
- DNA Barcode:
- CGTATCTCATGTAAAACCTCCAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- IL21R (50615)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488168
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 50615 | IL21R | interleukin 21 receptor | NM_021798.4 | 99.8% | 100% | 6G>A;21C>T;1605C>A |
| 2 | human | 50615 | IL21R | interleukin 21 receptor | NM_181078.3 | 99.8% | 100% | 6G>A;21C>T;1605C>A |
| 3 | human | 50615 | IL21R | interleukin 21 receptor | XM_017023257.2 | 99.8% | 100% | 6G>A;21C>T;1605C>A |
| 4 | human | 50615 | IL21R | interleukin 21 receptor | NM_181079.5 | 95.8% | 96% | (many diffs) |
| 5 | human | 50615 | IL21R | interleukin 21 receptor | XM_011545857.3 | 95.8% | 96% | (many diffs) |
| 6 | human | 50615 | IL21R | interleukin 21 receptor | XM_011545858.3 | 76.8% | 68.6% | 0_1ins217;135_136ins155;1233C>A |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 96
- ORF end:
- 1710
- ORF length:
- 1614
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggctccgc ggccgccccc ttcaccgtcg acagcatgcc acgtggctgg gccgctccct 121 tgctcctgct gctgctccag ggaggctggg gctgccccga cctcgtctgc tacaccgatt 181 acctccagac ggtcatctgc atcctggaaa tgtggaacct ccaccccagc acgctcaccc 241 ttacctggca agaccagtat gaagagctga aggacgaggc cacctcctgc agcctccaca 301 ggtcggccca caatgccacg catgccacct acacctgcca catggatgta ttccacttca 361 tggccgacga cattttcagt gtcaacatca cagaccagtc tggcaactac tcccaggagt 421 gtggcagctt tctcctggct gagagcatca agccggctcc ccctttcaac gtgactgtga 481 ccttctcagg acagtataat atctcctggc gctcagatta cgaagaccct gccttctaca 541 tgctgaaggg caagcttcag tatgagctgc agtacaggaa ccggggagac ccctgggctg 601 tgagtccgag gagaaagctg atctcagtgg actcaagaag tgtctccctc ctccccctgg 661 agttccgcaa agactcgagc tatgagctgc aggtgcgggc agggcccatg cctggctcct 721 cctaccaggg gacctggagt gaatggagtg acccggtcat ctttcagacc cagtcagagg 781 agttaaagga aggctggaac cctcacctgc tgcttctcct cctgcttgtc atagtcttca 841 ttcctgcctt ctggagcctg aagacccatc cattgtggag gctatggaag aagatatggg 901 ccgtccccag ccctgagcgg ttcttcatgc ccctgtacaa gggctgcagc ggagacttca 961 agaaatgggt gggtgcaccc ttcactggct ccagcctgga gctgggaccc tggagcccag 1021 aggtgccctc caccctggag gtgtacagct gccacccacc acggagcccg gccaagaggc 1081 tgcagctcac ggagctacaa gaaccagcag agctggtgga gtctgacggt gtgcccaagc 1141 ccagcttctg gccgacagcc cagaactcgg ggggctcagc ttacagtgag gagagggatc 1201 ggccatacgg cctggtgtcc attgacacag tgactgtgct agatgcagag gggccatgca 1261 cctggccctg cagctgtgag gatgacggct acccagccct ggacctggat gctggcctgg 1321 agcccagccc aggcctagag gacccactct tggatgcagg gaccacagtc ctgtcctgtg 1381 gctgtgtctc agctggcagc cctgggctag gagggcccct gggaagcctc ctggacagac 1441 taaagccacc ccttgcagat ggGGAGGACT GGGCTGGGGG ACTGCCCTGG GGTGGCCGGT 1501 CACCTGGAGG GGTCTCAGAG AGTGAGGCGG GCTCACCCCT GGCCGGCCTG GATATGGACA 1561 CGTTTGACAG TGGCTTTGTG GGCTCTGACT GCAGCAGCCC TGTGGAGTGT GACTTCACCA 1621 GCCCCGGGGA CGAAGGACCC CCCCGGAGCT ACCTCCGCCA GTGGGTGGTC ATTCCTCCGC 1681 CACTTTCGAG CCCTGGACCA CAGGCCAGCT AAGGATCCAA GGGTGGGCGC GCCGACCCAG 1741 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1801 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1861 TATCTTGTGG AAAGGACGAC GTATCTCATG TAAAACCTCC AACACGCGTT AAGTCgacaa 1921 tcaacctctg gattacaaaa tttgtgaaag att