Construct: ORF TRCN0000488187
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021746.1_s317c1
- DNA Barcode:
- TAGTGACAGGCCACATTACTATGT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- STAT6 (6778)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488187
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6778 | STAT6 | signal transducer and activ... | NM_001178078.2 | 100% | 100% | |
| 2 | human | 6778 | STAT6 | signal transducer and activ... | NM_001178079.2 | 100% | 100% | |
| 3 | human | 6778 | STAT6 | signal transducer and activ... | NM_003153.5 | 100% | 100% | |
| 4 | human | 6778 | STAT6 | signal transducer and activ... | XM_011538703.3 | 97.9% | 97.9% | 1511_1564del |
| 5 | human | 6778 | STAT6 | signal transducer and activ... | XM_011538704.3 | 97.9% | 97.9% | 1511_1564del |
| 6 | human | 6778 | STAT6 | signal transducer and activ... | XM_011538705.3 | 97.9% | 97.9% | 1511_1564del |
| 7 | human | 6778 | STAT6 | signal transducer and activ... | XM_011538707.3 | 97.9% | 97.9% | 1511_1564del |
| 8 | human | 6778 | STAT6 | signal transducer and activ... | NM_001178080.2 | 87% | 87% | 0_1ins330 |
| 9 | human | 6778 | STAT6 | signal transducer and activ... | NM_001178081.2 | 87% | 87% | 0_1ins330 |
| 10 | human | 6778 | STAT6 | signal transducer and activ... | XM_011538708.3 | 85.2% | 85.2% | 0_1ins330;1181_1234del |
| 11 | human | 6778 | STAT6 | signal transducer and activ... | NR_033659.2 | 60.6% | 1_255del;370_371ins139;2658_3824del | |
| 12 | mouse | 20852 | Stat6 | signal transducer and activ... | NM_009284.2 | 85% | 85.6% | (many diffs) |
| 13 | mouse | 20852 | Stat6 | signal transducer and activ... | XR_001779497.1 | 58.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2610
- ORF length:
- 2541
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gtctctgtgg ggtctggtct ccaagatgcc cccagaaaaa gtgcagcggc 121 tctatgtcga ctttccccaa cacctgcggc atcttctggg tgactggctg gagagccagc 181 cctgggagtt cctggtcggc tccgacgcct tctgctgcaa cttggctagt gccctacttt 241 cagacactgt ccagcacctt caggcctcgg tgggagagca gggggagggg agcaccatct 301 tgcaacacat cagcaccctt gagagcatat atcagaggga ccccctgaag ctggtggcca 361 ctttcagaca aatacttcaa ggagagaaaa aagctgttat ggaacagttc cgccacttgc 421 caatgccttt ccactggaag caggaagaac tcaagtttaa gacaggcttg cggaggctgc 481 agcaccgagt aggggagatc caccttctcc gagaagccct gcagaagggg gctgaggctg 541 gccaagtgtc tctgcacagc ttgatagaaa ctcctgctaa tgggactggg ccaagtgagg 601 ccctggccat gctactgcag gagaccactg gagagctaga ggcagccaaa gccctagtgc 661 tgaagaggat ccagatttgg aaacggcagc agcagctggc agggaatggc gcaccgtttg 721 aggagagcct ggccccactc caggagaggt gtgaaagcct ggtggacatt tattcccagc 781 tacagcagga ggtaggggcg gctggtgggg agcttgagcc caagacccgg gcatcgctga 841 ctggccggct ggatgaagtc ctgagaaccc tcgtcaccag ttgcttcctg gtggagaagc 901 agccccccca ggtactgaag actcagacca agttccaggc tggagttcga ttcctgttgg 961 gcttgaggtt cctgggggcc ccagccaagc ctccgctggt cagggccgac atggtgacag 1021 agaagcaggc gcgggagctg agtgtgcctc agggtcctgg ggctggagca gaaagcactg 1081 gagaaatcat caacaacact gtgcccttgg agaacagcat tcctgggaac tgctgctctg 1141 ccctgttcaa gaacctgctt ctcaagaaga tcaagcggtg tgagcggaag ggcactgagt 1201 ctgtcacaga ggagaagtgc gctgtgctct tctctgccag cttcacactt ggccccggca 1261 aactccccat ccagctccag gccctgtctc tgcccctggt ggtcatcgtc catggcaacc 1321 aagacaacaa tgccaaagcc actatcctgt gggacaatgc cttctctgag atggaccgcg 1381 tgccctttgt ggtggctgag cgggtgccct gggagaagat gtgtgaaact ctgaacctga 1441 agttcatggc tgaggtgggg accaaccggg ggctgctccc agagcacttc ctcttcctgg 1501 cccagaagat cttcaatgac aacagcctca gtatggaggc cttccagcac cgttctgtgt 1561 cctggtcgca gttcaacaag gagatcctgc tgggccgtgg cttcaccttt tggcagtggt 1621 ttgatggtgt cctggacctc accaaacgct gtctccggag ctactggtct gaccggctga 1681 tcattggctt catcagcaaa cagtacgtta ctagccttct tctcaatgag cccgacggaa 1741 cctttctcct ccgcttcagc gactcagaga ttgggggcat caccattgcc catgtcatcc 1801 ggggccagga tggctctcca cagatagaga acatccagcc attctctgcc aaagacctgt 1861 ccattcgctc actgggggac cgaatccggg atcttgctca gctcaaaaat ctctatccca 1921 agaagcccaa ggatgaggct ttccggagcc actacaagcc tgaacagatg ggtaaggatg 1981 gcaggggtta tgtcccagct accatcaaga tgaccgtgga aagggaccaa ccacttccta 2041 ccccagagct ccagatgcct accatggtgc cttcttatga ccttggaatg gcccctgatt 2101 cctccatgag catgcagctt ggcccagata tggtgcccca ggtgtaccca ccacactctc 2161 actccatccc cccgtatcaa ggcctctccc cagaagaatc agtcaacgtg ttgtcagcct 2221 tccaggagcc tcacctgcag atgcccccca gcctgggcca gatgagcctg ccctttgacc 2281 agcctcaccc ccagggcctg ctgccgtgcc agccTCAGGA GCATGCTGTG TCCAGCCCTG 2341 ACCCCCTGCT CTGCTCAGAT GTGACCATGG TGGAAGACAG CTGCCTGAGC CAGCCAGTGA 2401 CAGCGTTTCC TCAGGGCACT TGGATTGGTG AAGACATATT CCCTCCTCTG CTGCCTCCCA 2461 CTGAACAGGA CCTCACTAAG CTTCTCCTGG AGGGGCAAGG GGAGTCGGGG GGAGGGTCCT 2521 TGGGGGCACA GCCCCTCCTG CAGCCCTCCC ACTATGGGCA ATCTGGGATC TCAATGTCCC 2581 ACATGGACCT AAGGGCCAAC CCCAGTTGGT AGAACCCAGC TTTCTTGTAC AAAGTGGTTG 2641 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 2701 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATA 2761 GTGACAGGCC ACATTACTAT GTACGCGTTA AGTCgacaat caacctctgg attacaaaat 2821 ttgtgaaaga tt