Construct: ORF TRCN0000488216
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021701.1_s317c1
- DNA Barcode:
- AGCACGTACATTCCATTCTAACTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- ERBB2 (2064)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488216
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2064 | ERBB2 | erb-b2 receptor tyrosine ki... | NM_001005862.2 | 44.8% | 44.8% | 1_2025del |
| 2 | human | 2064 | ERBB2 | erb-b2 receptor tyrosine ki... | NM_001289936.1 | 44.3% | 44.3% | 1_2070del |
| 3 | human | 2064 | ERBB2 | erb-b2 receptor tyrosine ki... | NM_004448.3 | 43.8% | 43.8% | 1_2115del |
| 4 | human | 2064 | ERBB2 | erb-b2 receptor tyrosine ki... | XM_024450643.1 | 43.2% | 43.2% | 1_2163del |
| 5 | human | 2064 | ERBB2 | erb-b2 receptor tyrosine ki... | XM_024450642.1 | 42.7% | 42.7% | 1_2208del |
| 6 | human | 2064 | ERBB2 | erb-b2 receptor tyrosine ki... | XM_024450641.1 | 42.2% | 42.2% | 1_2253del |
| 7 | human | 2064 | ERBB2 | erb-b2 receptor tyrosine ki... | NR_110535.1 | 34.9% | 1_2439del;4090_4727del | |
| 8 | human | 2064 | ERBB2 | erb-b2 receptor tyrosine ki... | NM_001289937.1 | 27.7% | 27.7% | 1_2115del;3161_3163delATAinsG;3165_3166ins602 |
| 9 | mouse | 13866 | Erbb2 | erb-b2 receptor tyrosine ki... | NM_001003817.1 | 38.5% | 39.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 111
- ORF end:
- 1761
- ORF length:
- 1650
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttgca ggaaacggag ctggtggagc cgctgacacc tagcggagcg atgcccaacc 121 aggcgcagat gcggatcctg aaagagacgg agctgaggaa ggtgaaggtg cttggatctg 181 gcgcttttgg cacagtctac aagggcatct ggatccctga tggggagaat gtgaaaattc 241 cagtggccat caaagtgttg agggaaaaca catcccccaa agccaacaaa gaaatcttag 301 acgaagcata cgtgatggct ggtgtgggct ccccatatgt ctcccgcctt ctgggcatct 361 gcctgacatc cacggtgcag ctggtgacac agcttatgcc ctatggctgc ctcttagacc 421 atgtccggga aaaccgcgga cgcctgggct cccaggacct gctgaactgg tgtatgcaga 481 ttgccaaggg gatgagctac ctggaggatg tgcggctcgt acacagggac ttggccgctc 541 ggaacgtgct ggtcaagagt cccaaccatg tcaaaattac agacttcggg ctggctcggc 601 tgctggacat tgacgagaca gagtaccatg cagatggggg caaggtgccc atcaagtgga 661 tggcgctgga gtccattctc cgccggcggt tcacccacca gagtgatgtg tggagttatg 721 gtgtgactgt gtgggagctg atgacttttg gggccaaacc ttacgatggg atcccagccc 781 gggagatccc tgacctgctg gaaaaggggg agcggctgcc ccagcccccc atctgcacca 841 ttgatgtcta catgatcatg gtcaaatgtt ggatgattga ctctgaatgt cggccaagat 901 tccgggagtt ggtgtctgaa ttctcccgca tggccaggga cccccagcgc tttgtggtca 961 tccagaatga ggacttgggc ccagccagtc ccttggacag caccttctac cgctcactgc 1021 tggaggacga tgacatgggg gacctggtgg atgctgagga gtatctggta ccccagcagg 1081 gcttcttctg tccagaccct gccccgggcg ctgggggcat ggtccaccac aggcaccgca 1141 gctcatctac caggagtggc ggtggggacc tgacactagg gctggagccc tctgaagagg 1201 aggcccccag gtctccactg gcaccctccg aaggggctgg ctccgatgta tttgatggtg 1261 acctgggaat gggggcagcc aaggggctgc aaagcctccc cacacatgac cccagccctc 1321 tacagcggta cagtgaggac cccacagtac ccctgccctc tgagactgat ggctacgttg 1381 cccccctgac ctgcagcccc cagcctgaat atgtgaacca gccagatgtt cggccccagc 1441 ccccttcgcc ccgagagggc cctctgcctg ctgcccgacc TGCTGGTGCC ACTCTGGAAA 1501 GGCCCAAGAC TCTCTCCCCA GGGAAGAATG GGGTCGTCAA AGACGTTTTT GCCTTTGGGG 1561 GTGCCGTGGA GAACCCCGAG TACTTGACAC CCCAGGGAGG AGCTGCCCCT CAGCCCCACC 1621 CTCCTCCTGC CTTCAGCCCA GCCTTCGACA ACCTCTATTA CTGGGACCAG GACCCACCAG 1681 AGCGGGGGGC TCCACCCAGC ACCTTCAAAG GGACACCTAC GGCAGAGAAC CCAGAGTACC 1741 TGGGTCTGGA CGTGCCAGTG TGAGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1801 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1861 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA GCACGTACAT 1921 TCCATTCTAA CTCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1981 att