Transcript: Human NM_001289936.1

Homo sapiens erb-b2 receptor tyrosine kinase 2 (ERBB2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
ERBB2 (2064)
Length:
4940
CDS:
583..4305

Additional Resources:

NCBI RefSeq record:
NM_001289936.1
NBCI Gene record:
ERBB2 (2064)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148673 TTGGGATCCTCATCAAGCGA pXPR_003 CGG 1983 53% 21 0.6875 ERBB2 ERBB2 76377
2 BRDN0001146057 TCATCGCTCACAACCAAGTG pXPR_003 AGG 225 6% 7 0.2848 ERBB2 ERBB2 76376
3 BRDN0001148320 AACTACCTTTCTACGGACGT pXPR_003 GGG 875 24% 12 -0.5826 ERBB2 ERBB2 76378
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382352 GCCTTCGACAACCTCTATTAC pLKO_005 4183 CDS 100% 13.200 18.480 N ERBB2 n/a
2 TRCN0000010341 CAGTTACCAGTGCCAATATCC pLKO.1 1601 CDS 100% 4.950 6.930 N ERBB2 n/a
3 TRCN0000010343 GAAGTACACGATGCGGAGACT pLKO.1 2586 CDS 100% 2.640 3.696 N ERBB2 n/a
4 TRCN0000219708 AGCCTTCGACAACCTCTATTA pLKO.1 4182 CDS 100% 13.200 10.560 N ERBB2 n/a
5 TRCN0000199580 GCCAGGAACCTGTCCTAAGGA pLKO.1 4424 3UTR 100% 1.000 0.800 N ERBB2 n/a
6 TRCN0000219707 TGTGGCCTGTGCCCACTATAA pLKO.1 2289 CDS 100% 13.200 9.240 N ERBB2 n/a
7 TRCN0000196927 GAGATCACAGGTTACCTATAC pLKO.1 1750 CDS 100% 10.800 7.560 N ERBB2 n/a
8 TRCN0000381441 TCTGCTACCAGGACACGATTT pLKO_005 1019 CDS 100% 10.800 7.560 N ERBB2 n/a
9 TRCN0000039880 CAGCTCTTTGAGGACAACTAT pLKO.1 853 CDS 100% 5.625 3.938 N ERBB2 n/a
10 TRCN0000195369 CCCTAAGGGAGTGTCTAAGAA pLKO.1 4651 3UTR 100% 5.625 3.938 N ERBB2 n/a
11 TRCN0000010342 GATCACAGGTTACCTATACAT pLKO.1 1752 CDS 100% 5.625 3.938 N ERBB2 n/a
12 TRCN0000344488 GATCACAGGTTACCTATACAT pLKO_005 1752 CDS 100% 5.625 3.938 N ERBB2 n/a
13 TRCN0000023385 GCTGGCTGCAAGAAGATCTTT pLKO.1 1630 CDS 100% 5.625 3.938 N Erbb2 n/a
14 TRCN0000039878 TGTCAGTATCCAGGCTTTGTA pLKO.1 4742 3UTR 100% 5.625 3.938 N ERBB2 n/a
15 TRCN0000332953 TGTCAGTATCCAGGCTTTGTA pLKO_005 4742 3UTR 100% 5.625 3.938 N ERBB2 n/a
16 TRCN0000039881 CAGTGCCAATATCCAGGAGTT pLKO.1 1608 CDS 100% 4.050 2.835 N ERBB2 n/a
17 TRCN0000332883 CAGTGCCAATATCCAGGAGTT pLKO_005 1608 CDS 100% 4.050 2.835 N ERBB2 n/a
18 TRCN0000039882 GAATATGTGAACCAGCCAGAT pLKO.1 3949 CDS 100% 4.050 2.835 N ERBB2 n/a
19 TRCN0000332884 GAATATGTGAACCAGCCAGAT pLKO_005 3949 CDS 100% 4.050 2.835 N ERBB2 n/a
20 TRCN0000039879 GCCATCAAAGTGTTGAGGGAA pLKO.1 2788 CDS 100% 2.640 1.848 N ERBB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14631 pDONR223 0% 98.6% 98.3% None (many diffs) n/a
2 ccsbBroad304_14631 pLX_304 14.3% 98.6% 98.3% V5 (many diffs) n/a
3 TRCN0000480959 GTTAGCTTACCTCCTCCACAACTC pLX_317 10.4% 98.6% 98.3% V5 (many diffs) n/a
4 TRCN0000488053 AAAACCCGGGAGCTCTATGTCGAC pLX_317 7.3% 98.6% 98.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488513 ATAGCCGACTATGTACGGTATTTA pLX_317 8.2% 98.6% 98.3% V5 (many diffs) n/a
6 TRCN0000488216 AGCACGTACATTCCATTCTAACTC pLX_317 17.1% 44.3% 44.3% V5 (not translated due to prior stop codon) 1_2070del n/a
Download CSV