Construct: ORF TRCN0000488248
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020171.1_s317c1
- DNA Barcode:
- TATTATCCCCACGTCTTGCTAGTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAPK11 (5600)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488248
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5600 | MAPK11 | mitogen-activated protein k... | NM_002751.7 | 99.8% | 100% | 507T>C;756A>G |
| 2 | human | 5600 | MAPK11 | mitogen-activated protein k... | NR_110887.2 | 72.6% | (many diffs) | |
| 3 | mouse | 19094 | Mapk11 | mitogen-activated protein k... | NM_011161.5 | 88.9% | 97.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1164
- ORF length:
- 1092
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtcgggc cctcgcgccg gcttctaccg gcaggagctg aacaagaccg 121 tgtgggaggt gccgcagcgg ctgcaggggc tgcgcccggt gggctccggc gcctacggct 181 ccgtctgttc ggcctacgac gcccggctgc gccagaaggt ggcggtgaag aagctgtcgc 241 gccccttcca gtcgctgatc cacgcgcgca gaacgtaccg ggagctgcgg ctgctcaagc 301 acctgaagca cgagaacgtc atcgggcttc tggacgtctt cacgccggcc acgtccatcg 361 aggacttcag cgaagtgtac ttggtgacca ccctgatggg cgccgacctg aacaacatcg 421 tcaagtgcca ggcgctgagc gacgagcacg ttcaattcct ggtttaccag ctgctgcgcg 481 ggctgaagta catccactcg gccgggatca tccaccggga cctgaagccc agcaacgtgg 541 ctgtgaacga ggactgtgag ctcaggatcc tggatttcgg gctggcgcgc caggcggacg 601 aggagatgac cggctatgtg gccacgcgct ggtaccgggc acctgagatc atgctcaact 661 ggatgcatta caaccaaaca gtggatatct ggtccgtggg ctgcatcatg gctgagctgc 721 tccagggcaa ggccctcttc ccgggaagcg actacattga ccagctgaag cgcatcatgg 781 aagtggtggg cacacccagc cctgaggttc tggcaaaaat ctcctcggaa cacgcccgga 841 catatatcca gtccctgccc cccatgcccc agaaggacct gagcagcatc ttccgtggag 901 ccaaccccct ggccatagac ctccttGGAA GGATGCTGGT GCTGGACAGT GACCAGAGGG 961 TCAGTGCAGC TGAGGCACTG GCCCACGCCT ACTTCAGCCA GTACCACGAC CCCGAGGATG 1021 AGCCAGAGGC CGAGCCATAT GATGAGAGCG TTGAGGCCAA GGAGCGCACG CTGGAGGAGT 1081 GGAAGGAGCT CACTTACCAG GAAGTCCTCA GCTTCAAGCC CCCAGAGCCA CCGAAGCCAC 1141 CTGGCAGCCT GGAGATTGAG CAGTGAGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1201 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1261 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATATTATCC 1321 CCACGTCTTG CTAGTCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1381 aagatt