Construct: ORF TRCN0000488298
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021050.1_s317c1
- DNA Barcode:
- GAGTTCTCCAAGCTCTACCCGGCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- XCR1 (2829)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488298
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2829 | XCR1 | X-C motif chemokine receptor 1 | NM_001024644.2 | 99.7% | 100% | 111A>G;684C>T |
| 2 | human | 2829 | XCR1 | X-C motif chemokine receptor 1 | NM_005283.3 | 99.7% | 100% | 111A>G;684C>T |
| 3 | human | 2829 | XCR1 | X-C motif chemokine receptor 1 | XM_017006196.1 | 99.7% | 100% | 111A>G;684C>T |
| 4 | human | 2829 | XCR1 | X-C motif chemokine receptor 1 | XM_017006197.1 | 99.7% | 100% | 111A>G;684C>T |
| 5 | human | 2829 | XCR1 | X-C motif chemokine receptor 1 | XM_017006198.1 | 99.7% | 100% | 111A>G;684C>T |
| 6 | human | 2829 | XCR1 | X-C motif chemokine receptor 1 | XM_017006199.1 | 99.7% | 100% | 111A>G;684C>T |
| 7 | human | 2829 | XCR1 | X-C motif chemokine receptor 1 | XM_017006200.1 | 99.7% | 100% | 111A>G;684C>T |
| 8 | human | 2829 | XCR1 | X-C motif chemokine receptor 1 | XM_017006201.1 | 99.7% | 100% | 111A>G;684C>T |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1071
- ORF length:
- 999
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggagtcc tcaggcaacc cagagagcac cacctttttt tactatgacc 121 ttcagagcca gccgtgtgag aaccaggcct gggtctttgc taccctcgcc accactgtcc 181 tgtactgcct ggtgtttctc ctcagcctag tgggcaacag cctggtcctg tgggtcctgg 241 tgaagtatga gagcctggag tccctcacca acatcttcat cctcaacctg tgcctctcag 301 acctggtgtt cgcctgcttg ttgcctgtgt ggatctcccc ataccactgg ggctgggtgc 361 tgggagactt cctctgcaaa ctcctcaata tgatcttctc catcagcctc tacagcagca 421 tcttcttcct gaccatcatg accatccacc gctacctgtc ggtagtgagc cccctctcca 481 ccctgcgcgt ccccaccctc cgctgccggg tgctggtgac catggctgtg tgggtagcca 541 gcatcctgtc ctccatcctc gacaccatct tccacaaggt gctttcttcg ggctgtgatt 601 attccgaact cacgtggtac ctcacctccg tctaccagca caacctcttc ttcctgctgt 661 ccctggggat tatcctgttc tgctacgtgg agatcctcag gaccctgttc cgctcacgct 721 ccaagcggcg ccaccgcacg gtcaagctca tctttgccat cgtggtggcc tacttcctca 781 gctggggtcc ctacaacttc accctgtttc tgcagacgct gtttcggacc cagatcatcc 841 GGAGCTGCGA GGCCAAACAG CAGCTAGAAT ACGCCCTGCT CATCTGCCGC AACCTCGCCT 901 TCTCCCACTG CTGCTTTAAC CCGGTGCTCT ATGTCTTCGT GGGGGTCAAG TTCCGCACAC 961 ACCTGAAACA TGTTCTCCGG CAGTTCTGGT TCTGCCGGCT GCAGGCACCC AGCCCAGCCT 1021 CGATCCCCCA CTCCCCTGGT GCCTTCGCCT ATGAGGGCGC CTCCTTCTAC TAGAACCCAG 1081 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1141 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1201 TATCTTGTGG AAAGGACGAG AGTTCTCCAA GCTCTACCCG GCAACGCGTT AAGTCgacaa 1261 tcaacctctg gattacaaaa tttgtgaaag att