Transcript: Human XM_017006198.1

PREDICTED: Homo sapiens X-C motif chemokine receptor 1 (XCR1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XCR1 (2829)
Length:
6265
CDS:
1308..2309

Additional Resources:

NCBI RefSeq record:
XM_017006198.1
NBCI Gene record:
XCR1 (2829)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014296 CCTCTGCAAACTCCTCAATAT pLKO.1 1607 CDS 100% 13.200 9.240 N XCR1 n/a
2 TRCN0000358249 GGCCAAACAGCAGCTAGAATA pLKO_005 2087 CDS 100% 13.200 9.240 N XCR1 n/a
3 TRCN0000368568 TCCTCTGCAAACTCCTCAATA pLKO_005 1606 CDS 100% 13.200 9.240 N XCR1 n/a
4 TRCN0000358248 TTCTTCGGGCTGTGATTATTC pLKO_005 1820 CDS 100% 13.200 9.240 N XCR1 n/a
5 TRCN0000014294 CCCTACAACTTCACCCTGTTT pLKO.1 2025 CDS 100% 4.950 3.465 N XCR1 n/a
6 TRCN0000014295 GCTGTGATTATTCCGAACTCA pLKO.1 1828 CDS 100% 3.000 2.100 N XCR1 n/a
7 TRCN0000014293 CCTCAATATGATCTTCTCCAT pLKO.1 1619 CDS 100% 2.640 1.848 N XCR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00671 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00671 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000488298 GAGTTCTCCAAGCTCTACCCGGCA pLX_317 23.7% 99.7% 100% V5 (not translated due to prior stop codon) 111A>G;684C>T n/a
4 TRCN0000492223 GTGTACCCGTGAATATTGCTATAC pLX_317 29.6% 99.7% 99.7% V5 111A>G;684C>T;999_1000insG n/a
Download CSV