Construct: ORF TRCN0000488323
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020851.1_s317c1
- DNA Barcode:
- GAACACATCACCCAAAATATCTGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- GPR143 (4935)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488323
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4935 | GPR143 | G protein-coupled receptor 143 | NM_000273.3 | 95.2% | 95.2% | 0_1ins60 |
| 2 | human | 4935 | GPR143 | G protein-coupled receptor 143 | XM_005274541.3 | 90.3% | 88% | (many diffs) |
| 3 | human | 4935 | GPR143 | G protein-coupled receptor 143 | XM_024452387.1 | 75.4% | 75.4% | 0_1ins312 |
| 4 | human | 4935 | GPR143 | G protein-coupled receptor 143 | XM_024452388.1 | 75.4% | 75.4% | 0_1ins312 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1344
- ORF length:
- 1272
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgacccag gcaggccggc ggggtcctgg cacacccgag ccgcgtccgc 121 gaacacagcc catggcctcc ccgcgcctag ggaccttctg ctgccccacg cgggacgcag 181 ccacgcagct cgtgctgagc ttccagccgc gggccttcca cgcgctctgc ctgggcagcg 241 gcgggctccg cttggcgctg ggccttctgc agctgctgcc cggccgccgg cccgcgggcc 301 ccgggtcccc cgcgacgtcc ccgccggcct cggtccgcat cctgcgcgct gccgctgcct 361 gcgaccttct cggctgcctg ggtatggtga tccggtccac cgtgtggtta ggattcccaa 421 attttgttga cagcgtctcg gatatgaacc acacggaaat ttggcctgct gctttctgcg 481 tggggagtgc gatgtggatc cagctgttgt acagtgcctg cttctggtgg ctgttttgct 541 atgcagtgga tgcttatctg gtgatccgga gatcggcagg actgagcacc atcctgctgt 601 atcacatcat ggcgtggggc ctggccaccc tgctctgtgt ggagggagcc gccatgctct 661 actacccttc cgtgtccagg tgtgagcggg gcctggacca cgccatcccc cactatgtca 721 ccatgtacct gcccctgctg ctggttctcg tggcgaaccc catcctgttc caaaagacag 781 tgactgcagt ggcctcttta cttaaaggaa gacaaggcat ttacacggag aacgagagga 841 ggatgggagc cgtgatcaag atccgatttt tcaaaatcat gctggtttta attatttgtt 901 ggttgtcgaa tatcatcaat gaaagccttt tattctatct tgagatgcaa acagatatca 961 atggaggttc tttgaaacct gtcagaactg cagccaagac cacatggttt attatgggaa 1021 tcctgaatcc agcccaggga tttcTCTTGT CTTTGGCCTT CTACGGCTGG ACAGGATGCA 1081 GCCTGGGTTT TCAGTCTCCC AGGAAGGAGA TCCAGTGGGA ATCACTGACC ACCTCGGCTG 1141 CTGAGGGGGC TCACCCATCC CCACTGATGC CCCATGAAAA CCCTGCTTCC GGGAAGGTGT 1201 CTCAAGTGGG TGGGCAGACT TCTGACGAAG CCCTGAGCAT GCTGTCTGAA GGTTCTGATG 1261 CCAGCACAAT TGAAATTCAC ACTGCAAGTG AATCCTGCAA CAAAAATGAG GGTGACCCTG 1321 CTCTCCCAAC CCATGGAGAC CTATAGAACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1381 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1441 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGAACACAT 1501 CACCCAAAAT ATCTGAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1561 aagatt